Incidental Mutation 'R1718:Smarcc2'
ID191217
Institutional Source Beutler Lab
Gene Symbol Smarcc2
Ensembl Gene ENSMUSG00000025369
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2
Synonyms5930405J04Rik
MMRRC Submission 039751-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.871) question?
Stock #R1718 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128459248-128490482 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 128468998 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026433] [ENSMUST00000099131] [ENSMUST00000105235] [ENSMUST00000218228]
Predicted Effect probably benign
Transcript: ENSMUST00000026433
SMART Domains Protein: ENSMUSP00000026433
Gene: ENSMUSG00000025369

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
CHROMO 186 235 5.97e-6 SMART
low complexity region 297 307 N/A INTRINSIC
Pfam:SWIRM 424 512 4.9e-38 PFAM
low complexity region 545 557 N/A INTRINSIC
SANT 597 645 9.04e-12 SMART
low complexity region 768 816 N/A INTRINSIC
low complexity region 861 879 N/A INTRINSIC
coiled coil region 906 921 N/A INTRINSIC
low complexity region 948 982 N/A INTRINSIC
low complexity region 985 1010 N/A INTRINSIC
low complexity region 1012 1062 N/A INTRINSIC
low complexity region 1074 1098 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099131
SMART Domains Protein: ENSMUSP00000096734
Gene: ENSMUSG00000025369

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
CHROMO 186 235 5.97e-6 SMART
low complexity region 297 307 N/A INTRINSIC
Pfam:SWIRM 424 512 3.9e-38 PFAM
SANT 628 676 9.04e-12 SMART
low complexity region 799 847 N/A INTRINSIC
low complexity region 892 910 N/A INTRINSIC
coiled coil region 937 952 N/A INTRINSIC
low complexity region 979 1013 N/A INTRINSIC
low complexity region 1016 1041 N/A INTRINSIC
low complexity region 1043 1093 N/A INTRINSIC
low complexity region 1105 1129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105235
SMART Domains Protein: ENSMUSP00000100868
Gene: ENSMUSG00000025369

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
CHROMO 186 235 5.97e-6 SMART
low complexity region 297 307 N/A INTRINSIC
Pfam:SWIRM 426 512 4.5e-35 PFAM
low complexity region 545 557 N/A INTRINSIC
SANT 597 645 9.04e-12 SMART
Pfam:SWIRM-assoc_3 684 750 4.1e-34 PFAM
low complexity region 768 816 N/A INTRINSIC
Pfam:SWIRM-assoc_1 863 946 1.5e-34 PFAM
low complexity region 948 982 N/A INTRINSIC
low complexity region 985 1010 N/A INTRINSIC
low complexity region 1012 1062 N/A INTRINSIC
low complexity region 1077 1093 N/A INTRINSIC
low complexity region 1108 1123 N/A INTRINSIC
low complexity region 1153 1177 N/A INTRINSIC
low complexity region 1184 1212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220384
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and contains a predicted leucine zipper motif typical of many transcription factors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit a slight increase in embryo weight at E13.5 and die shortly after birth (P0-P3). Mice homozygous for a conditional allele activated in the brain exhibit reduced cerebral cortical size and thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik G T 13: 77,245,370 probably benign Het
Acot3 T G 12: 84,053,943 probably null Het
Acox1 A T 11: 116,174,682 C523* probably null Het
Adamts19 G A 18: 58,972,825 C764Y probably damaging Het
Agrn GCTCT GCTCTCT 4: 156,166,519 probably null Het
Apob A G 12: 8,016,087 K4319R probably benign Het
AU016765 A C 17: 64,555,438 noncoding transcript Het
Bpifb1 T A 2: 154,213,983 probably null Het
Btn2a2 A G 13: 23,481,936 V242A probably benign Het
Camta1 A G 4: 151,084,024 S1281P probably benign Het
Ccdc116 T C 16: 17,141,908 K306E probably benign Het
Cemip A G 7: 83,935,658 V1350A probably benign Het
Clip2 A T 5: 134,502,929 L674* probably null Het
Cyp2d12 T A 15: 82,558,050 D244E probably benign Het
Cyp4x1 A G 4: 115,111,670 V379A possibly damaging Het
Dnah9 T A 11: 66,168,079 H130L possibly damaging Het
Enpp7 A G 11: 118,990,983 Y318C probably damaging Het
Fras1 A T 5: 96,554,889 probably null Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm28042 T A 2: 120,036,391 S172T possibly damaging Het
Gm7808 T A 9: 19,928,003 probably benign Het
Gm8909 A G 17: 36,161,784 probably benign Het
Gpr61 C T 3: 108,150,380 V322M possibly damaging Het
Hapln3 A G 7: 79,123,450 V15A unknown Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Klk1b4 A G 7: 44,209,672 Y38C probably damaging Het
Lrrfip1 A G 1: 91,115,555 K561E probably damaging Het
Map3k1 A G 13: 111,755,419 C1101R probably benign Het
Mcoln2 A G 3: 146,190,474 probably benign Het
Mfsd2b G A 12: 4,869,037 T73I probably damaging Het
Mfsd4b5 C T 10: 39,975,203 V19I probably benign Het
Mgme1 T A 2: 144,272,318 D113E probably benign Het
Mki67 A G 7: 135,695,494 S2604P probably damaging Het
Mob3c A G 4: 115,831,644 I125V probably benign Het
Mrps9 G A 1: 42,903,399 R339H probably damaging Het
Ndst1 T C 18: 60,707,803 D269G probably damaging Het
Nedd9 T C 13: 41,338,926 N30S probably damaging Het
Notch4 G A 17: 34,576,763 probably benign Het
Olfr1095 A T 2: 86,851,187 N170K probably benign Het
Olfr250 A G 9: 38,367,594 D6G probably benign Het
Olfr877 G A 9: 37,855,453 V212I probably benign Het
Olfr995 T C 2: 85,438,805 M118V probably benign Het
Papss1 C A 3: 131,619,185 R447S probably damaging Het
Pla2g4a C T 1: 149,871,523 probably benign Het
Rab11fip2 A G 19: 59,935,649 F266L probably damaging Het
Ralgapb T A 2: 158,443,280 Y554* probably null Het
Rem2 T C 14: 54,479,150 V240A probably damaging Het
Retsat T C 6: 72,602,671 V143A probably benign Het
Rnf141 G T 7: 110,821,273 Q175K probably damaging Het
Rtcb C A 10: 85,942,017 G431V probably damaging Het
Slc7a6os A G 8: 106,204,339 W222R probably damaging Het
Smchd1 A T 17: 71,448,833 Y218N possibly damaging Het
Sp110 G A 1: 85,594,385 H66Y probably benign Het
Speg G A 1: 75,417,863 E1739K probably benign Het
Speg A G 1: 75,421,744 Q1945R possibly damaging Het
Sprtn T C 8: 124,898,357 V67A probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tnks1bp1 G T 2: 85,071,738 E997D probably benign Het
Tti1 A T 2: 158,008,224 V365E probably benign Het
Tulp4 A G 17: 6,222,440 I590V probably benign Het
Vmn2r61 A G 7: 42,300,697 D847G probably benign Het
Zfp184 A G 13: 21,959,272 T383A possibly damaging Het
Zik1 T A 7: 10,492,341 E33V probably damaging Het
Zik1 C A 7: 10,492,342 E33* probably null Het
Other mutations in Smarcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Smarcc2 APN 10 128463055 missense probably damaging 0.97
IGL01450:Smarcc2 APN 10 128469320 missense probably damaging 1.00
IGL01638:Smarcc2 APN 10 128488074 unclassified probably benign
IGL01663:Smarcc2 APN 10 128488977 unclassified probably benign
IGL02308:Smarcc2 APN 10 128482772 missense probably damaging 1.00
IGL02511:Smarcc2 APN 10 128461382 missense probably damaging 1.00
IGL02633:Smarcc2 APN 10 128469687 missense probably damaging 1.00
IGL03375:Smarcc2 APN 10 128482912 missense probably damaging 0.99
IGL03493:Smarcc2 APN 10 128461357 missense probably damaging 1.00
PIT4403001:Smarcc2 UTSW 10 128463024 missense probably damaging 1.00
R0220:Smarcc2 UTSW 10 128483636 missense probably benign 0.32
R0281:Smarcc2 UTSW 10 128474722 missense probably benign 0.20
R1299:Smarcc2 UTSW 10 128461378 missense probably damaging 1.00
R1447:Smarcc2 UTSW 10 128469791 critical splice donor site probably null
R1466:Smarcc2 UTSW 10 128474245 missense probably damaging 0.98
R1466:Smarcc2 UTSW 10 128474245 missense probably damaging 0.98
R1498:Smarcc2 UTSW 10 128482192 missense probably benign 0.02
R1499:Smarcc2 UTSW 10 128463872 missense probably damaging 0.99
R1616:Smarcc2 UTSW 10 128482793 missense probably damaging 1.00
R1767:Smarcc2 UTSW 10 128469082 missense possibly damaging 0.92
R1792:Smarcc2 UTSW 10 128463871 missense probably damaging 1.00
R1965:Smarcc2 UTSW 10 128474758 missense probably damaging 1.00
R2229:Smarcc2 UTSW 10 128488341 unclassified probably benign
R2286:Smarcc2 UTSW 10 128463743 missense possibly damaging 0.58
R2367:Smarcc2 UTSW 10 128482167 missense possibly damaging 0.86
R2398:Smarcc2 UTSW 10 128469682 missense possibly damaging 0.92
R3084:Smarcc2 UTSW 10 128488159 unclassified probably benign
R3085:Smarcc2 UTSW 10 128488159 unclassified probably benign
R3777:Smarcc2 UTSW 10 128482943 critical splice donor site probably null
R4346:Smarcc2 UTSW 10 128468823 missense probably benign 0.02
R4967:Smarcc2 UTSW 10 128483180 missense probably damaging 0.99
R4992:Smarcc2 UTSW 10 128474710 missense probably damaging 0.99
R5028:Smarcc2 UTSW 10 128461445 missense probably damaging 0.99
R5071:Smarcc2 UTSW 10 128463940 missense probably damaging 1.00
R5095:Smarcc2 UTSW 10 128469300 missense probably damaging 0.99
R5133:Smarcc2 UTSW 10 128461473 critical splice donor site probably null
R5180:Smarcc2 UTSW 10 128487362 unclassified probably benign
R5231:Smarcc2 UTSW 10 128461352 missense probably damaging 1.00
R5240:Smarcc2 UTSW 10 128481006 critical splice donor site probably null
R5401:Smarcc2 UTSW 10 128465504 missense probably damaging 1.00
R5445:Smarcc2 UTSW 10 128488074 unclassified probably benign
R5690:Smarcc2 UTSW 10 128484407 missense probably damaging 1.00
R5694:Smarcc2 UTSW 10 128484127 missense probably benign
R6240:Smarcc2 UTSW 10 128488024 unclassified probably benign
R6545:Smarcc2 UTSW 10 128484128 missense probably benign 0.00
R6713:Smarcc2 UTSW 10 128487769 intron probably null
R6934:Smarcc2 UTSW 10 128469672 missense probably benign 0.27
R7016:Smarcc2 UTSW 10 128485329 intron probably null
R7149:Smarcc2 UTSW 10 128482729 missense probably damaging 1.00
R7229:Smarcc2 UTSW 10 128488048 missense unknown
R7395:Smarcc2 UTSW 10 128485606 missense probably damaging 1.00
Z1088:Smarcc2 UTSW 10 128461434 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCAGCGAGTGAAATTGAAGCATC -3'
(R):5'- GTTTACCCTCCAGTTCCCAGCAAG -3'

Sequencing Primer
(F):5'- TTGAAGCATCTGTGGAGGAC -3'
(R):5'- CTTGCCTCAGGTGTAAGCTAAG -3'
Posted On2014-05-14