Incidental Mutation 'R1718:Mfsd2b'
ID191221
Institutional Source Beutler Lab
Gene Symbol Mfsd2b
Ensembl Gene ENSMUSG00000037336
Gene Namemajor facilitator superfamily domain containing 2B
SynonymsGm1964
MMRRC Submission 039751-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R1718 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location4862440-4874359 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4869037 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 73 (T73I)
Ref Sequence ENSEMBL: ENSMUSP00000117057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045921] [ENSMUST00000085790] [ENSMUST00000137337] [ENSMUST00000147241]
Predicted Effect probably damaging
Transcript: ENSMUST00000045921
AA Change: T176I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045315
Gene: ENSMUSG00000037336
AA Change: T176I

DomainStartEndE-ValueType
Pfam:MFS_2 33 472 4.6e-74 PFAM
low complexity region 476 490 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085790
AA Change: T176I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082945
Gene: ENSMUSG00000037336
AA Change: T176I

DomainStartEndE-ValueType
Pfam:MFS_2 32 346 2.2e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125344
Predicted Effect probably damaging
Transcript: ENSMUST00000137337
AA Change: T73I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117057
Gene: ENSMUSG00000037336
AA Change: T73I

DomainStartEndE-ValueType
Pfam:MFS_2 1 368 1.1e-59 PFAM
low complexity region 373 387 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143446
Predicted Effect probably benign
Transcript: ENSMUST00000147241
SMART Domains Protein: ENSMUSP00000114977
Gene: ENSMUSG00000037336

DomainStartEndE-ValueType
Pfam:MFS_2 33 110 3.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153676
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 100% (69/69)
MGI Phenotype PHENOTYPE: Homozygous KO reduces sphingosine-1-phosphate export from, and increases its accumulation in, red blood cells and platelets, and leads to reduced leukocyte, reticulocyte, and erythrocyte cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik G T 13: 77,245,370 probably benign Het
Acot3 T G 12: 84,053,943 probably null Het
Acox1 A T 11: 116,174,682 C523* probably null Het
Adamts19 G A 18: 58,972,825 C764Y probably damaging Het
Agrn GCTCT GCTCTCT 4: 156,166,519 probably null Het
Apob A G 12: 8,016,087 K4319R probably benign Het
AU016765 A C 17: 64,555,438 noncoding transcript Het
Bpifb1 T A 2: 154,213,983 probably null Het
Btn2a2 A G 13: 23,481,936 V242A probably benign Het
Camta1 A G 4: 151,084,024 S1281P probably benign Het
Ccdc116 T C 16: 17,141,908 K306E probably benign Het
Cemip A G 7: 83,935,658 V1350A probably benign Het
Clip2 A T 5: 134,502,929 L674* probably null Het
Cyp2d12 T A 15: 82,558,050 D244E probably benign Het
Cyp4x1 A G 4: 115,111,670 V379A possibly damaging Het
Dnah9 T A 11: 66,168,079 H130L possibly damaging Het
Enpp7 A G 11: 118,990,983 Y318C probably damaging Het
Fras1 A T 5: 96,554,889 probably null Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm28042 T A 2: 120,036,391 S172T possibly damaging Het
Gm7808 T A 9: 19,928,003 probably benign Het
Gm8909 A G 17: 36,161,784 probably benign Het
Gpr61 C T 3: 108,150,380 V322M possibly damaging Het
Hapln3 A G 7: 79,123,450 V15A unknown Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Klk1b4 A G 7: 44,209,672 Y38C probably damaging Het
Lrrfip1 A G 1: 91,115,555 K561E probably damaging Het
Map3k1 A G 13: 111,755,419 C1101R probably benign Het
Mcoln2 A G 3: 146,190,474 probably benign Het
Mfsd4b5 C T 10: 39,975,203 V19I probably benign Het
Mgme1 T A 2: 144,272,318 D113E probably benign Het
Mki67 A G 7: 135,695,494 S2604P probably damaging Het
Mob3c A G 4: 115,831,644 I125V probably benign Het
Mrps9 G A 1: 42,903,399 R339H probably damaging Het
Ndst1 T C 18: 60,707,803 D269G probably damaging Het
Nedd9 T C 13: 41,338,926 N30S probably damaging Het
Notch4 G A 17: 34,576,763 probably benign Het
Olfr1095 A T 2: 86,851,187 N170K probably benign Het
Olfr250 A G 9: 38,367,594 D6G probably benign Het
Olfr877 G A 9: 37,855,453 V212I probably benign Het
Olfr995 T C 2: 85,438,805 M118V probably benign Het
Papss1 C A 3: 131,619,185 R447S probably damaging Het
Pla2g4a C T 1: 149,871,523 probably benign Het
Rab11fip2 A G 19: 59,935,649 F266L probably damaging Het
Ralgapb T A 2: 158,443,280 Y554* probably null Het
Rem2 T C 14: 54,479,150 V240A probably damaging Het
Retsat T C 6: 72,602,671 V143A probably benign Het
Rnf141 G T 7: 110,821,273 Q175K probably damaging Het
Rtcb C A 10: 85,942,017 G431V probably damaging Het
Slc7a6os A G 8: 106,204,339 W222R probably damaging Het
Smarcc2 T C 10: 128,468,998 probably benign Het
Smchd1 A T 17: 71,448,833 Y218N possibly damaging Het
Sp110 G A 1: 85,594,385 H66Y probably benign Het
Speg G A 1: 75,417,863 E1739K probably benign Het
Speg A G 1: 75,421,744 Q1945R possibly damaging Het
Sprtn T C 8: 124,898,357 V67A probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tnks1bp1 G T 2: 85,071,738 E997D probably benign Het
Tti1 A T 2: 158,008,224 V365E probably benign Het
Tulp4 A G 17: 6,222,440 I590V probably benign Het
Vmn2r61 A G 7: 42,300,697 D847G probably benign Het
Zfp184 A G 13: 21,959,272 T383A possibly damaging Het
Zik1 T A 7: 10,492,341 E33V probably damaging Het
Zik1 C A 7: 10,492,342 E33* probably null Het
Other mutations in Mfsd2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Mfsd2b APN 12 4866469 missense possibly damaging 0.63
IGL03188:Mfsd2b APN 12 4866538 splice site probably null
IGL03339:Mfsd2b APN 12 4874335 start codon destroyed probably null
R0142:Mfsd2b UTSW 12 4866234 missense probably benign 0.11
R1468:Mfsd2b UTSW 12 4870536 nonsense probably null
R1468:Mfsd2b UTSW 12 4870536 nonsense probably null
R1535:Mfsd2b UTSW 12 4870605 missense probably damaging 1.00
R1894:Mfsd2b UTSW 12 4869155 missense probably damaging 0.99
R2127:Mfsd2b UTSW 12 4867659 missense probably benign 0.01
R2392:Mfsd2b UTSW 12 4865164 missense possibly damaging 0.73
R3737:Mfsd2b UTSW 12 4870578 missense probably damaging 1.00
R3738:Mfsd2b UTSW 12 4870578 missense probably damaging 1.00
R3739:Mfsd2b UTSW 12 4870578 missense probably damaging 1.00
R3956:Mfsd2b UTSW 12 4866848 missense probably damaging 1.00
R4035:Mfsd2b UTSW 12 4870578 missense probably damaging 1.00
R4244:Mfsd2b UTSW 12 4874356 utr 5 prime probably benign
R4595:Mfsd2b UTSW 12 4865807 missense possibly damaging 0.87
R4667:Mfsd2b UTSW 12 4867636 missense probably benign 0.01
R4723:Mfsd2b UTSW 12 4868992 missense probably benign 0.03
R5126:Mfsd2b UTSW 12 4866183 missense probably benign 0.30
R5145:Mfsd2b UTSW 12 4865908 unclassified probably benign
R5890:Mfsd2b UTSW 12 4867651 missense probably damaging 1.00
R5976:Mfsd2b UTSW 12 4866522 missense probably damaging 1.00
R6753:Mfsd2b UTSW 12 4867358 missense possibly damaging 0.90
R6912:Mfsd2b UTSW 12 4870611 nonsense probably null
X0062:Mfsd2b UTSW 12 4865170 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCAGCATCCCCTCTCAAAAGGAAG -3'
(R):5'- AAGCCTGTCGTTACGTCTGCTTATC -3'

Sequencing Primer
(F):5'- TCCCCTCTCAAAAGGAAGAAAAG -3'
(R):5'- TGGGAGAAGCTGTCCTAACC -3'
Posted On2014-05-14