Incidental Mutation 'R1718:Btn2a2'
ID191225
Institutional Source Beutler Lab
Gene Symbol Btn2a2
Ensembl Gene ENSMUSG00000053216
Gene Namebutyrophilin, subfamily 2, member A2
Synonyms
MMRRC Submission 039751-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R1718 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location23477676-23488857 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23481936 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 242 (V242A)
Ref Sequence ENSEMBL: ENSMUSP00000153680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041541] [ENSMUST00000110432] [ENSMUST00000110433] [ENSMUST00000223877]
Predicted Effect probably benign
Transcript: ENSMUST00000041541
AA Change: V242A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000048251
Gene: ENSMUSG00000053216
AA Change: V242A

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
IG 37 144 9.12e-7 SMART
Pfam:C2-set_2 148 231 3.3e-8 PFAM
transmembrane domain 250 272 N/A INTRINSIC
coiled coil region 276 304 N/A INTRINSIC
PRY 312 364 1.87e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110432
AA Change: V242A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106062
Gene: ENSMUSG00000053216
AA Change: V242A

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
IG 37 144 9.12e-7 SMART
Blast:IG_like 151 211 1e-29 BLAST
transmembrane domain 250 272 N/A INTRINSIC
coiled coil region 276 304 N/A INTRINSIC
PRY 312 364 1.87e-27 SMART
SPRY 365 485 3.56e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110433
AA Change: V242A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106063
Gene: ENSMUSG00000053216
AA Change: V242A

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
IG 37 144 9.12e-7 SMART
Pfam:C2-set_2 148 231 1.2e-8 PFAM
transmembrane domain 250 272 N/A INTRINSIC
coiled coil region 276 304 N/A INTRINSIC
PRY 312 364 1.87e-27 SMART
SPRY 365 485 3.56e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223877
AA Change: V242A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Butyrophilin is the major protein associated with fat droplets in the milk. This gene is a member of the BTN2 subfamily of genes, which encode proteins belonging to the butyrophilin protein family. The gene is located in a cluster on chromosome 6, consisting of seven genes belonging to the expanding B7/butyrophilin-like group, a subset of the immunoglobulin gene superfamily. The encoded protein is a type I receptor glycoprotein involved in lipid, fatty-acid and sterol metabolism. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik G T 13: 77,245,370 probably benign Het
Acot3 T G 12: 84,053,943 probably null Het
Acox1 A T 11: 116,174,682 C523* probably null Het
Adamts19 G A 18: 58,972,825 C764Y probably damaging Het
Agrn GCTCT GCTCTCT 4: 156,166,519 probably null Het
Apob A G 12: 8,016,087 K4319R probably benign Het
AU016765 A C 17: 64,555,438 noncoding transcript Het
Bpifb1 T A 2: 154,213,983 probably null Het
Camta1 A G 4: 151,084,024 S1281P probably benign Het
Ccdc116 T C 16: 17,141,908 K306E probably benign Het
Cemip A G 7: 83,935,658 V1350A probably benign Het
Clip2 A T 5: 134,502,929 L674* probably null Het
Cyp2d12 T A 15: 82,558,050 D244E probably benign Het
Cyp4x1 A G 4: 115,111,670 V379A possibly damaging Het
Dnah9 T A 11: 66,168,079 H130L possibly damaging Het
Enpp7 A G 11: 118,990,983 Y318C probably damaging Het
Fras1 A T 5: 96,554,889 probably null Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm28042 T A 2: 120,036,391 S172T possibly damaging Het
Gm7808 T A 9: 19,928,003 probably benign Het
Gm8909 A G 17: 36,161,784 probably benign Het
Gpr61 C T 3: 108,150,380 V322M possibly damaging Het
Hapln3 A G 7: 79,123,450 V15A unknown Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Klk1b4 A G 7: 44,209,672 Y38C probably damaging Het
Lrrfip1 A G 1: 91,115,555 K561E probably damaging Het
Map3k1 A G 13: 111,755,419 C1101R probably benign Het
Mcoln2 A G 3: 146,190,474 probably benign Het
Mfsd2b G A 12: 4,869,037 T73I probably damaging Het
Mfsd4b5 C T 10: 39,975,203 V19I probably benign Het
Mgme1 T A 2: 144,272,318 D113E probably benign Het
Mki67 A G 7: 135,695,494 S2604P probably damaging Het
Mob3c A G 4: 115,831,644 I125V probably benign Het
Mrps9 G A 1: 42,903,399 R339H probably damaging Het
Ndst1 T C 18: 60,707,803 D269G probably damaging Het
Nedd9 T C 13: 41,338,926 N30S probably damaging Het
Notch4 G A 17: 34,576,763 probably benign Het
Olfr1095 A T 2: 86,851,187 N170K probably benign Het
Olfr250 A G 9: 38,367,594 D6G probably benign Het
Olfr877 G A 9: 37,855,453 V212I probably benign Het
Olfr995 T C 2: 85,438,805 M118V probably benign Het
Papss1 C A 3: 131,619,185 R447S probably damaging Het
Pla2g4a C T 1: 149,871,523 probably benign Het
Rab11fip2 A G 19: 59,935,649 F266L probably damaging Het
Ralgapb T A 2: 158,443,280 Y554* probably null Het
Rem2 T C 14: 54,479,150 V240A probably damaging Het
Retsat T C 6: 72,602,671 V143A probably benign Het
Rnf141 G T 7: 110,821,273 Q175K probably damaging Het
Rtcb C A 10: 85,942,017 G431V probably damaging Het
Slc7a6os A G 8: 106,204,339 W222R probably damaging Het
Smarcc2 T C 10: 128,468,998 probably benign Het
Smchd1 A T 17: 71,448,833 Y218N possibly damaging Het
Sp110 G A 1: 85,594,385 H66Y probably benign Het
Speg G A 1: 75,417,863 E1739K probably benign Het
Speg A G 1: 75,421,744 Q1945R possibly damaging Het
Sprtn T C 8: 124,898,357 V67A probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tnks1bp1 G T 2: 85,071,738 E997D probably benign Het
Tti1 A T 2: 158,008,224 V365E probably benign Het
Tulp4 A G 17: 6,222,440 I590V probably benign Het
Vmn2r61 A G 7: 42,300,697 D847G probably benign Het
Zfp184 A G 13: 21,959,272 T383A possibly damaging Het
Zik1 T A 7: 10,492,341 E33V probably damaging Het
Zik1 C A 7: 10,492,342 E33* probably null Het
Other mutations in Btn2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Btn2a2 APN 13 23478576 missense probably damaging 1.00
IGL00740:Btn2a2 APN 13 23478485 missense probably benign
IGL02053:Btn2a2 APN 13 23478820 missense probably damaging 1.00
IGL02720:Btn2a2 APN 13 23480467 missense probably benign 0.15
IGL02738:Btn2a2 APN 13 23478806 nonsense probably null
IGL03010:Btn2a2 APN 13 23486205 nonsense probably null
IGL03221:Btn2a2 APN 13 23478449 missense probably damaging 1.00
R0066:Btn2a2 UTSW 13 23478485 missense probably benign 0.01
R0066:Btn2a2 UTSW 13 23478485 missense probably benign 0.01
R0597:Btn2a2 UTSW 13 23486410 missense probably benign 0.12
R0749:Btn2a2 UTSW 13 23478398 makesense probably null
R1209:Btn2a2 UTSW 13 23480566 critical splice donor site probably null
R1283:Btn2a2 UTSW 13 23478832 missense probably damaging 0.98
R2925:Btn2a2 UTSW 13 23481814 missense probably damaging 1.00
R3824:Btn2a2 UTSW 13 23480465 missense probably benign 0.02
R5281:Btn2a2 UTSW 13 23478832 missense probably damaging 0.98
R5356:Btn2a2 UTSW 13 23482875 missense probably benign 0.02
R5482:Btn2a2 UTSW 13 23486387 missense probably benign 0.03
R5535:Btn2a2 UTSW 13 23478275 missense probably benign 0.14
R5629:Btn2a2 UTSW 13 23481960 splice site probably null
R5930:Btn2a2 UTSW 13 23486228 missense probably damaging 0.96
R5952:Btn2a2 UTSW 13 23482808 missense probably benign 0.09
R6006:Btn2a2 UTSW 13 23486363 missense probably damaging 1.00
R6196:Btn2a2 UTSW 13 23487845 missense possibly damaging 0.74
R6373:Btn2a2 UTSW 13 23481829 missense probably benign 0.00
R6533:Btn2a2 UTSW 13 23481781 nonsense probably null
R6891:Btn2a2 UTSW 13 23482844 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGTTCTGAGCACTTCTGCTGCAC -3'
(R):5'- TCCAATCCTTGTTCCTGAGGGAGAG -3'

Sequencing Primer
(F):5'- aactctcctactctactcttttacc -3'
(R):5'- CTGAGGGAGAGACCCCAG -3'
Posted On2014-05-14