Incidental Mutation 'R1718:Gm8909'
ID191234
Institutional Source Beutler Lab
Gene Symbol Gm8909
Ensembl Gene ENSMUSG00000073402
Gene Namepredicted gene 8909
Synonyms
MMRRC Submission 039751-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R1718 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location36164443-36168537 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 36161784 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040467] [ENSMUST00000097335] [ENSMUST00000173353]
Predicted Effect probably benign
Transcript: ENSMUST00000040467
SMART Domains Protein: ENSMUSP00000036092
Gene: ENSMUSG00000073402

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 26 204 5.9e-96 PFAM
IGc1 223 294 8.23e-23 SMART
transmembrane domain 310 332 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000056774
Predicted Effect noncoding transcript
Transcript: ENSMUST00000090537
SMART Domains Protein: ENSMUSP00000088025
Gene: ENSMUSG00000038311

DomainStartEndE-ValueType
SCOP:d2sqca2 105 173 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097335
SMART Domains Protein: ENSMUSP00000094947
Gene: ENSMUSG00000073402

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 54 232 7.3e-96 PFAM
IGc1 251 322 8.23e-23 SMART
transmembrane domain 338 360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173025
SMART Domains Protein: ENSMUSP00000133655
Gene: ENSMUSG00000038311

DomainStartEndE-ValueType
SCOP:d2sqca2 148 216 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173353
SMART Domains Protein: ENSMUSP00000133663
Gene: ENSMUSG00000073402

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 54 232 3.9e-93 PFAM
IGc1 251 322 8.23e-23 SMART
transmembrane domain 338 360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174752
Meta Mutation Damage Score 0.0844 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik G T 13: 77,245,370 probably benign Het
Acot3 T G 12: 84,053,943 probably null Het
Acox1 A T 11: 116,174,682 C523* probably null Het
Adamts19 G A 18: 58,972,825 C764Y probably damaging Het
Agrn GCTCT GCTCTCT 4: 156,166,519 probably null Het
Apob A G 12: 8,016,087 K4319R probably benign Het
AU016765 A C 17: 64,555,438 noncoding transcript Het
Bpifb1 T A 2: 154,213,983 probably null Het
Btn2a2 A G 13: 23,481,936 V242A probably benign Het
Camta1 A G 4: 151,084,024 S1281P probably benign Het
Ccdc116 T C 16: 17,141,908 K306E probably benign Het
Cemip A G 7: 83,935,658 V1350A probably benign Het
Clip2 A T 5: 134,502,929 L674* probably null Het
Cyp2d12 T A 15: 82,558,050 D244E probably benign Het
Cyp4x1 A G 4: 115,111,670 V379A possibly damaging Het
Dnah9 T A 11: 66,168,079 H130L possibly damaging Het
Enpp7 A G 11: 118,990,983 Y318C probably damaging Het
Fras1 A T 5: 96,554,889 probably null Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm28042 T A 2: 120,036,391 S172T possibly damaging Het
Gm7808 T A 9: 19,928,003 probably benign Het
Gpr61 C T 3: 108,150,380 V322M possibly damaging Het
Hapln3 A G 7: 79,123,450 V15A unknown Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Klk1b4 A G 7: 44,209,672 Y38C probably damaging Het
Lrrfip1 A G 1: 91,115,555 K561E probably damaging Het
Map3k1 A G 13: 111,755,419 C1101R probably benign Het
Mcoln2 A G 3: 146,190,474 probably benign Het
Mfsd2b G A 12: 4,869,037 T73I probably damaging Het
Mfsd4b5 C T 10: 39,975,203 V19I probably benign Het
Mgme1 T A 2: 144,272,318 D113E probably benign Het
Mki67 A G 7: 135,695,494 S2604P probably damaging Het
Mob3c A G 4: 115,831,644 I125V probably benign Het
Mrps9 G A 1: 42,903,399 R339H probably damaging Het
Ndst1 T C 18: 60,707,803 D269G probably damaging Het
Nedd9 T C 13: 41,338,926 N30S probably damaging Het
Notch4 G A 17: 34,576,763 probably benign Het
Olfr1095 A T 2: 86,851,187 N170K probably benign Het
Olfr250 A G 9: 38,367,594 D6G probably benign Het
Olfr877 G A 9: 37,855,453 V212I probably benign Het
Olfr995 T C 2: 85,438,805 M118V probably benign Het
Papss1 C A 3: 131,619,185 R447S probably damaging Het
Pla2g4a C T 1: 149,871,523 probably benign Het
Rab11fip2 A G 19: 59,935,649 F266L probably damaging Het
Ralgapb T A 2: 158,443,280 Y554* probably null Het
Rem2 T C 14: 54,479,150 V240A probably damaging Het
Retsat T C 6: 72,602,671 V143A probably benign Het
Rnf141 G T 7: 110,821,273 Q175K probably damaging Het
Rtcb C A 10: 85,942,017 G431V probably damaging Het
Slc7a6os A G 8: 106,204,339 W222R probably damaging Het
Smarcc2 T C 10: 128,468,998 probably benign Het
Smchd1 A T 17: 71,448,833 Y218N possibly damaging Het
Sp110 G A 1: 85,594,385 H66Y probably benign Het
Speg G A 1: 75,417,863 E1739K probably benign Het
Speg A G 1: 75,421,744 Q1945R possibly damaging Het
Sprtn T C 8: 124,898,357 V67A probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tnks1bp1 G T 2: 85,071,738 E997D probably benign Het
Tti1 A T 2: 158,008,224 V365E probably benign Het
Tulp4 A G 17: 6,222,440 I590V probably benign Het
Vmn2r61 A G 7: 42,300,697 D847G probably benign Het
Zfp184 A G 13: 21,959,272 T383A possibly damaging Het
Zik1 T A 7: 10,492,341 E33V probably damaging Het
Zik1 C A 7: 10,492,342 E33* probably null Het
Other mutations in Gm8909
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Gm8909 APN 17 36165354 critical splice donor site probably null
IGL00534:Gm8909 APN 17 36168129 missense probably damaging 1.00
IGL02312:Gm8909 APN 17 36165407 missense probably benign 0.01
IGL03346:Gm8909 APN 17 36168109 missense probably damaging 1.00
H8441:Gm8909 UTSW 17 36167982 missense possibly damaging 0.84
R0005:Gm8909 UTSW 17 36162192 unclassified probably benign
R0078:Gm8909 UTSW 17 36165461 missense possibly damaging 0.95
R0211:Gm8909 UTSW 17 36168007 missense probably damaging 1.00
R0211:Gm8909 UTSW 17 36168007 missense probably damaging 1.00
R0233:Gm8909 UTSW 17 36167469 missense probably benign 0.42
R0233:Gm8909 UTSW 17 36167469 missense probably benign 0.42
R0553:Gm8909 UTSW 17 36168057 missense probably damaging 1.00
R0670:Gm8909 UTSW 17 36168098 missense possibly damaging 0.74
R1937:Gm8909 UTSW 17 36168007 missense probably damaging 1.00
R2571:Gm8909 UTSW 17 36167661 missense possibly damaging 0.66
R4393:Gm8909 UTSW 17 36161969 unclassified probably benign
R4396:Gm8909 UTSW 17 36161969 unclassified probably benign
R4409:Gm8909 UTSW 17 36165850 missense possibly damaging 0.53
R4505:Gm8909 UTSW 17 36161480 unclassified probably benign
R4506:Gm8909 UTSW 17 36161480 unclassified probably benign
R4507:Gm8909 UTSW 17 36161480 unclassified probably benign
R4579:Gm8909 UTSW 17 36161757 unclassified probably benign
R4684:Gm8909 UTSW 17 36165858 missense possibly damaging 0.90
R4740:Gm8909 UTSW 17 36167556 missense probably damaging 1.00
R5087:Gm8909 UTSW 17 36165416 nonsense probably null
R5103:Gm8909 UTSW 17 36161685 unclassified probably benign
R5275:Gm8909 UTSW 17 36161675 unclassified probably null
R5425:Gm8909 UTSW 17 36168485 missense probably damaging 1.00
R6155:Gm8909 UTSW 17 36167507 missense possibly damaging 0.93
R6727:Gm8909 UTSW 17 36165730 missense probably damaging 1.00
R6852:Gm8909 UTSW 17 36168073 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CACTTGGAAACTCTTCTCATGGCCC -3'
(R):5'- TCCTGGCAGATCTCAGAACTCAGAC -3'

Sequencing Primer
(F):5'- TCATGGCCCTCTGCGAC -3'
(R):5'- CGAAAGCTGCTTCTGCTG -3'
Posted On2014-05-14