Incidental Mutation 'R1720:Baat'
ID191361
Institutional Source Beutler Lab
Gene Symbol Baat
Ensembl Gene ENSMUSG00000039653
Gene Namebile acid-Coenzyme A: amino acid N-acyltransferase
Synonymstaurine N-acyltransferase, BAT
MMRRC Submission 039752-MU
Accession Numbers

Genbank: NM_007519; MGI: 106642

 

Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R1720 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location49489422-49506557 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49490231 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 284 (F284L)
Ref Sequence ENSEMBL: ENSMUSP00000129603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043056] [ENSMUST00000166036]
Predicted Effect probably benign
Transcript: ENSMUST00000043056
AA Change: F284L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041983
Gene: ENSMUSG00000039653
AA Change: F284L

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 13 145 1.7e-44 PFAM
low complexity region 149 162 N/A INTRINSIC
Pfam:BAAT_C 206 414 8.1e-77 PFAM
Pfam:DLH 285 412 5.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166036
AA Change: F284L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129603
Gene: ENSMUSG00000039653
AA Change: F284L

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 14 144 5.1e-45 PFAM
low complexity region 149 162 N/A INTRINSIC
Pfam:BAAT_C 206 414 1.2e-77 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a liver enzyme that catalyzes the transfer of C24 bile acids from the acyl-CoA thioester to either glycine or taurine, the second step in the formation of bile acid-amino acid conjugates. The bile acid conjugates then act as a detergent in the gastrointestinal tract, which enhances lipid and fat-soluble vitamin absorption. Defects in this gene are a cause of familial hypercholanemia (FHCA). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A G 11: 97,771,609 F146L probably damaging Het
9330182L06Rik T G 5: 9,428,407 C424G probably damaging Het
Acot5 A G 12: 84,075,881 D413G probably benign Het
Actr5 G T 2: 158,636,137 V476F possibly damaging Het
Adhfe1 G A 1: 9,566,900 D426N probably benign Het
Adra1a T C 14: 66,638,278 L234P probably damaging Het
Akap9 G T 5: 3,972,791 V1207L possibly damaging Het
Anapc2 A G 2: 25,274,712 D36G probably benign Het
Apol8 A G 15: 77,749,366 S337P possibly damaging Het
Asxl3 A T 18: 22,452,435 D139V probably damaging Het
Atp13a4 A T 16: 29,408,928 V1037E probably damaging Het
C1qtnf6 A T 15: 78,527,440 F40Y probably damaging Het
Caskin2 G A 11: 115,802,782 H508Y probably damaging Het
Cass4 A T 2: 172,427,734 I579F probably damaging Het
Cdk15 A G 1: 59,289,758 Y277C probably damaging Het
Cit G A 5: 115,967,897 D947N probably damaging Het
Clint1 T A 11: 45,887,410 I126K probably damaging Het
Col6a4 C T 9: 106,026,472 G1640E probably damaging Het
Ddx10 T C 9: 53,238,071 K119E probably damaging Het
Dennd1a G A 2: 37,800,197 Q964* probably null Het
Dnhd1 T C 7: 105,693,828 F1460L probably benign Het
Edc3 T C 9: 57,748,179 probably null Het
Edn1 A G 13: 42,305,350 E163G probably benign Het
Efl1 A T 7: 82,683,721 D317V possibly damaging Het
F2 A T 2: 91,628,830 Y430* probably null Het
Faap100 C T 11: 120,374,581 V490M probably damaging Het
Fuz G T 7: 44,896,991 G104W probably damaging Het
Greb1l C A 18: 10,553,848 H1616Q probably benign Het
Grm1 G T 10: 10,746,794 probably null Het
Gucy2d G T 7: 98,477,230 A1098S probably benign Het
H1f0 T A 15: 79,028,995 S92T possibly damaging Het
Hbb-bt T A 7: 103,813,876 probably benign Het
Heg1 G A 16: 33,707,179 A170T probably benign Het
Hspa4l A T 3: 40,781,617 K578* probably null Het
Ikbke A G 1: 131,259,210 S582P possibly damaging Het
Itga6 T A 2: 71,820,166 F185L probably damaging Het
Itgal T A 7: 127,306,927 D396E probably benign Het
Kif5b T C 18: 6,213,427 H687R probably benign Het
Kmt2c T C 5: 25,299,184 N3709D probably benign Het
Lipf A T 19: 33,965,666 K125* probably null Het
Lrif1 A T 3: 106,733,136 E512D probably damaging Het
Matn2 T A 15: 34,345,274 Y142* probably null Het
Med13l A G 5: 118,741,995 T1051A probably damaging Het
Mpp3 T A 11: 102,025,756 M1L possibly damaging Het
Mro C T 18: 73,876,735 S159L probably benign Het
Myh15 T A 16: 49,092,782 D367E probably damaging Het
Myo1g T C 11: 6,512,490 Q547R probably benign Het
Neb T C 2: 52,207,721 I902M probably benign Het
Nsd1 G A 13: 55,246,898 D771N probably damaging Het
Olfr1507 A C 14: 52,490,594 Y40* probably null Het
Olfr248 A G 1: 174,391,920 I284V probably benign Het
Olfr294 T C 7: 86,616,456 N63S probably damaging Het
Olfr434 T C 6: 43,217,560 S216P probably damaging Het
Olfr912 C T 9: 38,581,289 T4I probably benign Het
Penk A G 4: 4,134,240 Y136H probably damaging Het
Prdm6 C T 18: 53,540,200 S144L probably benign Het
Ptprq T A 10: 107,686,294 I599F probably damaging Het
Racgap1 A T 15: 99,628,769 C304* probably null Het
Rbp3 T C 14: 33,956,909 V938A probably benign Het
Rpp30 A G 19: 36,094,427 K132E probably damaging Het
Rxfp2 A T 5: 150,043,099 R101* probably null Het
Ryr1 A T 7: 29,101,870 V823E probably damaging Het
S100pbp A T 4: 129,182,093 D146E probably damaging Het
Sdr9c7 T A 10: 127,902,258 V135E probably damaging Het
Serpinb12 A G 1: 106,946,614 D23G probably damaging Het
Serpinf1 T A 11: 75,413,981 T185S probably null Het
Slc23a1 A C 18: 35,625,851 C96G possibly damaging Het
Slc5a4a C T 10: 76,189,269 probably null Het
Suco A T 1: 161,834,054 L936Q probably damaging Het
Tmem144 T C 3: 79,825,299 Y224C probably damaging Het
Tpm4 T A 8: 72,144,754 probably null Het
Ttn T C 2: 76,730,070 E29329G probably damaging Het
Txn1 T C 4: 57,943,922 I101V probably benign Het
Ube2o A T 11: 116,544,607 C452S probably benign Het
Uhrf1bp1l T C 10: 89,782,586 V141A probably damaging Het
Uxs1 A T 1: 43,764,921 I278N probably damaging Het
Vps54 T C 11: 21,306,519 F663L probably damaging Het
Wdfy3 CG C 5: 101,926,525 probably null Het
Zc3h11a A G 1: 133,621,701 S741P probably damaging Het
Zdbf2 G A 1: 63,303,277 V272I possibly damaging Het
Zdhhc24 A G 19: 4,878,951 N68S probably damaging Het
Znfx1 A T 2: 167,044,066 L858* probably null Het
Other mutations in Baat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Baat APN 4 49490352 missense probably damaging 1.00
IGL01124:Baat APN 4 49490391 missense possibly damaging 0.82
IGL01327:Baat APN 4 49490338 missense probably damaging 1.00
IGL02394:Baat APN 4 49489812 unclassified probably benign
IGL03267:Baat APN 4 49490050 missense probably benign 0.00
R0085:Baat UTSW 4 49490425 splice site probably benign
R1467:Baat UTSW 4 49503101 missense probably benign
R1467:Baat UTSW 4 49503101 missense probably benign
R2309:Baat UTSW 4 49499718 missense probably damaging 1.00
R2992:Baat UTSW 4 49499675 nonsense probably null
R4383:Baat UTSW 4 49499731 missense probably damaging 1.00
R4602:Baat UTSW 4 49502727 missense probably damaging 1.00
R5190:Baat UTSW 4 49499652 missense probably damaging 1.00
R5259:Baat UTSW 4 49490070 missense probably benign 0.08
R5456:Baat UTSW 4 49502949 missense possibly damaging 0.91
R5988:Baat UTSW 4 49502871 missense probably damaging 1.00
R6265:Baat UTSW 4 49502836 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGGCTTGGGATCAAAATGGGCATC -3'
(R):5'- GCACCTGAGTGGCTTCTGTAAGTG -3'

Sequencing Primer
(F):5'- GTAAGACAGCAGAGTCCAATTCTTC -3'
(R):5'- AATCTGAGATTGTGGATTTCCTAATG -3'
Posted On2014-05-14