Incidental Mutation 'R1720:Akap9'
ID191364
Institutional Source Beutler Lab
Gene Symbol Akap9
Ensembl Gene ENSMUSG00000040407
Gene NameA kinase (PRKA) anchor protein (yotiao) 9
SynonymsAKAP450, G1-448-15, 5730481H23Rik, mei2-5, repro12
MMRRC Submission 039752-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.408) question?
Stock #R1720 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location3928054-4081310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 3972791 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 1207 (V1207L)
Ref Sequence ENSEMBL: ENSMUSP00000046129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044492]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044492
AA Change: V1207L

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000046129
Gene: ENSMUSG00000040407
AA Change: V1207L

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
Blast:HPT 126 197 6e-21 BLAST
low complexity region 237 249 N/A INTRINSIC
low complexity region 297 315 N/A INTRINSIC
coiled coil region 404 593 N/A INTRINSIC
coiled coil region 622 756 N/A INTRINSIC
coiled coil region 777 843 N/A INTRINSIC
coiled coil region 888 958 N/A INTRINSIC
low complexity region 982 997 N/A INTRINSIC
coiled coil region 1037 1065 N/A INTRINSIC
low complexity region 1233 1246 N/A INTRINSIC
internal_repeat_2 1247 1312 7.75e-5 PROSPERO
internal_repeat_1 1377 1485 2.63e-5 PROSPERO
coiled coil region 1522 1589 N/A INTRINSIC
coiled coil region 1789 2107 N/A INTRINSIC
coiled coil region 2132 2318 N/A INTRINSIC
internal_repeat_1 2322 2445 2.63e-5 PROSPERO
coiled coil region 2455 2494 N/A INTRINSIC
low complexity region 2587 2598 N/A INTRINSIC
low complexity region 2627 2640 N/A INTRINSIC
internal_repeat_2 2934 2997 7.75e-5 PROSPERO
low complexity region 3000 3016 N/A INTRINSIC
coiled coil region 3109 3307 N/A INTRINSIC
coiled coil region 3455 3493 N/A INTRINSIC
coiled coil region 3521 3556 N/A INTRINSIC
Pfam:PACT_coil_coil 3576 3657 1.2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123119
Predicted Effect probably benign
Transcript: ENSMUST00000133952
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a chemically induced allele exhibit male infertily with abnormal spermatogenesis and Sertoli maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A G 11: 97,771,609 F146L probably damaging Het
9330182L06Rik T G 5: 9,428,407 C424G probably damaging Het
Acot5 A G 12: 84,075,881 D413G probably benign Het
Actr5 G T 2: 158,636,137 V476F possibly damaging Het
Adhfe1 G A 1: 9,566,900 D426N probably benign Het
Adra1a T C 14: 66,638,278 L234P probably damaging Het
Anapc2 A G 2: 25,274,712 D36G probably benign Het
Apol8 A G 15: 77,749,366 S337P possibly damaging Het
Asxl3 A T 18: 22,452,435 D139V probably damaging Het
Atp13a4 A T 16: 29,408,928 V1037E probably damaging Het
Baat A T 4: 49,490,231 F284L probably benign Het
C1qtnf6 A T 15: 78,527,440 F40Y probably damaging Het
Caskin2 G A 11: 115,802,782 H508Y probably damaging Het
Cass4 A T 2: 172,427,734 I579F probably damaging Het
Cdk15 A G 1: 59,289,758 Y277C probably damaging Het
Cit G A 5: 115,967,897 D947N probably damaging Het
Clint1 T A 11: 45,887,410 I126K probably damaging Het
Col6a4 C T 9: 106,026,472 G1640E probably damaging Het
Ddx10 T C 9: 53,238,071 K119E probably damaging Het
Dennd1a G A 2: 37,800,197 Q964* probably null Het
Dnhd1 T C 7: 105,693,828 F1460L probably benign Het
Edc3 T C 9: 57,748,179 probably null Het
Edn1 A G 13: 42,305,350 E163G probably benign Het
Efl1 A T 7: 82,683,721 D317V possibly damaging Het
F2 A T 2: 91,628,830 Y430* probably null Het
Faap100 C T 11: 120,374,581 V490M probably damaging Het
Fuz G T 7: 44,896,991 G104W probably damaging Het
Greb1l C A 18: 10,553,848 H1616Q probably benign Het
Grm1 G T 10: 10,746,794 probably null Het
Gucy2d G T 7: 98,477,230 A1098S probably benign Het
H1f0 T A 15: 79,028,995 S92T possibly damaging Het
Hbb-bt T A 7: 103,813,876 probably benign Het
Heg1 G A 16: 33,707,179 A170T probably benign Het
Hspa4l A T 3: 40,781,617 K578* probably null Het
Ikbke A G 1: 131,259,210 S582P possibly damaging Het
Itga6 T A 2: 71,820,166 F185L probably damaging Het
Itgal T A 7: 127,306,927 D396E probably benign Het
Kif5b T C 18: 6,213,427 H687R probably benign Het
Kmt2c T C 5: 25,299,184 N3709D probably benign Het
Lipf A T 19: 33,965,666 K125* probably null Het
Lrif1 A T 3: 106,733,136 E512D probably damaging Het
Matn2 T A 15: 34,345,274 Y142* probably null Het
Med13l A G 5: 118,741,995 T1051A probably damaging Het
Mpp3 T A 11: 102,025,756 M1L possibly damaging Het
Mro C T 18: 73,876,735 S159L probably benign Het
Myh15 T A 16: 49,092,782 D367E probably damaging Het
Myo1g T C 11: 6,512,490 Q547R probably benign Het
Neb T C 2: 52,207,721 I902M probably benign Het
Nsd1 G A 13: 55,246,898 D771N probably damaging Het
Olfr1507 A C 14: 52,490,594 Y40* probably null Het
Olfr248 A G 1: 174,391,920 I284V probably benign Het
Olfr294 T C 7: 86,616,456 N63S probably damaging Het
Olfr434 T C 6: 43,217,560 S216P probably damaging Het
Olfr912 C T 9: 38,581,289 T4I probably benign Het
Penk A G 4: 4,134,240 Y136H probably damaging Het
Prdm6 C T 18: 53,540,200 S144L probably benign Het
Ptprq T A 10: 107,686,294 I599F probably damaging Het
Racgap1 A T 15: 99,628,769 C304* probably null Het
Rbp3 T C 14: 33,956,909 V938A probably benign Het
Rpp30 A G 19: 36,094,427 K132E probably damaging Het
Rxfp2 A T 5: 150,043,099 R101* probably null Het
Ryr1 A T 7: 29,101,870 V823E probably damaging Het
S100pbp A T 4: 129,182,093 D146E probably damaging Het
Sdr9c7 T A 10: 127,902,258 V135E probably damaging Het
Serpinb12 A G 1: 106,946,614 D23G probably damaging Het
Serpinf1 T A 11: 75,413,981 T185S probably null Het
Slc23a1 A C 18: 35,625,851 C96G possibly damaging Het
Slc5a4a C T 10: 76,189,269 probably null Het
Suco A T 1: 161,834,054 L936Q probably damaging Het
Tmem144 T C 3: 79,825,299 Y224C probably damaging Het
Tpm4 T A 8: 72,144,754 probably null Het
Ttn T C 2: 76,730,070 E29329G probably damaging Het
Txn1 T C 4: 57,943,922 I101V probably benign Het
Ube2o A T 11: 116,544,607 C452S probably benign Het
Uhrf1bp1l T C 10: 89,782,586 V141A probably damaging Het
Uxs1 A T 1: 43,764,921 I278N probably damaging Het
Vps54 T C 11: 21,306,519 F663L probably damaging Het
Wdfy3 CG C 5: 101,926,525 probably null Het
Zc3h11a A G 1: 133,621,701 S741P probably damaging Het
Zdbf2 G A 1: 63,303,277 V272I possibly damaging Het
Zdhhc24 A G 19: 4,878,951 N68S probably damaging Het
Znfx1 A T 2: 167,044,066 L858* probably null Het
Other mutations in Akap9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Akap9 APN 5 4046639 missense probably damaging 0.97
IGL00642:Akap9 APN 5 3960842 missense probably damaging 0.99
IGL00786:Akap9 APN 5 4070522 missense probably damaging 1.00
IGL00788:Akap9 APN 5 4060480 missense probably damaging 1.00
IGL00969:Akap9 APN 5 4001550 missense probably benign
IGL01014:Akap9 APN 5 3968683 missense probably benign 0.41
IGL01302:Akap9 APN 5 3970711 missense probably benign 0.27
IGL01610:Akap9 APN 5 4032839 missense possibly damaging 0.95
IGL01620:Akap9 APN 5 3960218 missense probably benign 0.11
IGL01862:Akap9 APN 5 3951705 missense probably damaging 0.99
IGL01862:Akap9 APN 5 4065856 missense probably damaging 0.99
IGL02151:Akap9 APN 5 4032728 nonsense probably null
IGL02635:Akap9 APN 5 4070500 missense possibly damaging 0.59
IGL02858:Akap9 APN 5 4069130 missense possibly damaging 0.88
IGL02967:Akap9 APN 5 3976164 missense probably benign 0.07
IGL03064:Akap9 APN 5 3968755 missense probably damaging 1.00
IGL03289:Akap9 APN 5 4077261 missense probably damaging 1.00
wee_one UTSW 5 4043925 missense probably damaging 1.00
FR4449:Akap9 UTSW 5 3981214 unclassified probably benign
PIT1430001:Akap9 UTSW 5 4029849 missense probably damaging 1.00
PIT4366001:Akap9 UTSW 5 4046221 missense probably benign 0.24
R0088:Akap9 UTSW 5 3961946 missense probably benign 0.22
R0309:Akap9 UTSW 5 4069038 missense probably benign 0.01
R0387:Akap9 UTSW 5 3951678 splice site probably benign
R0440:Akap9 UTSW 5 4064569 missense probably damaging 0.99
R0441:Akap9 UTSW 5 3961714 missense probably benign 0.15
R0491:Akap9 UTSW 5 3972851 unclassified probably benign
R0501:Akap9 UTSW 5 3970685 missense probably damaging 1.00
R0507:Akap9 UTSW 5 4069043 missense probably benign 0.41
R0544:Akap9 UTSW 5 4069185 missense probably benign 0.22
R0581:Akap9 UTSW 5 4050620 missense probably benign 0.03
R0611:Akap9 UTSW 5 3954870 missense probably benign 0.00
R0620:Akap9 UTSW 5 4064136 missense probably damaging 0.98
R0639:Akap9 UTSW 5 4060318 missense probably damaging 1.00
R0932:Akap9 UTSW 5 4046492 missense possibly damaging 0.77
R0944:Akap9 UTSW 5 4064742 synonymous probably null
R1101:Akap9 UTSW 5 4046205 missense probably benign 0.00
R1159:Akap9 UTSW 5 3960865 missense probably damaging 0.98
R1170:Akap9 UTSW 5 4055671 missense probably benign
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1453:Akap9 UTSW 5 3975614 unclassified probably null
R1551:Akap9 UTSW 5 4069174 missense probably benign 0.02
R1608:Akap9 UTSW 5 3961783 missense probably damaging 1.00
R1652:Akap9 UTSW 5 4077210 missense probably damaging 1.00
R1659:Akap9 UTSW 5 4064633 missense probably damaging 1.00
R1713:Akap9 UTSW 5 4039345 critical splice donor site probably null
R1719:Akap9 UTSW 5 3957645 nonsense probably null
R1757:Akap9 UTSW 5 4001667 missense probably benign 0.41
R1872:Akap9 UTSW 5 4001406 missense probably damaging 1.00
R1876:Akap9 UTSW 5 3961809 missense probably benign 0.28
R1881:Akap9 UTSW 5 4050173 missense probably benign
R1950:Akap9 UTSW 5 3960677 missense probably damaging 1.00
R1980:Akap9 UTSW 5 3972771 missense probably damaging 0.99
R1993:Akap9 UTSW 5 4038520 splice site probably null
R2008:Akap9 UTSW 5 3960131 missense possibly damaging 0.47
R2020:Akap9 UTSW 5 3961967 missense probably damaging 1.00
R2051:Akap9 UTSW 5 3975685 nonsense probably null
R2061:Akap9 UTSW 5 3961010 missense probably damaging 1.00
R2109:Akap9 UTSW 5 4044847 missense possibly damaging 0.47
R2135:Akap9 UTSW 5 4064509 missense probably damaging 1.00
R2225:Akap9 UTSW 5 4077271 missense probably damaging 0.96
R2232:Akap9 UTSW 5 4046603 missense probably damaging 1.00
R2424:Akap9 UTSW 5 4065279 missense probably damaging 0.97
R2483:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R2879:Akap9 UTSW 5 3976353 intron probably benign
R3622:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3623:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3624:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3722:Akap9 UTSW 5 4070351 missense probably damaging 1.00
R3806:Akap9 UTSW 5 3954410 missense probably benign 0.00
R3919:Akap9 UTSW 5 3961764 nonsense probably null
R4023:Akap9 UTSW 5 3992077 missense possibly damaging 0.66
R4093:Akap9 UTSW 5 4043996 missense probably damaging 0.99
R4434:Akap9 UTSW 5 4032708 missense probably damaging 0.99
R4529:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4530:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4532:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4533:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4585:Akap9 UTSW 5 3976151 missense probably benign 0.00
R4586:Akap9 UTSW 5 3976151 missense probably benign 0.00
R4655:Akap9 UTSW 5 4046403 missense probably benign 0.14
R4676:Akap9 UTSW 5 4032774 missense probably damaging 1.00
R4676:Akap9 UTSW 5 4064515 nonsense probably null
R4724:Akap9 UTSW 5 4055339 missense probably benign
R4731:Akap9 UTSW 5 3962266 missense possibly damaging 0.54
R4732:Akap9 UTSW 5 4013901 missense probably damaging 0.98
R4733:Akap9 UTSW 5 4013901 missense probably damaging 0.98
R4743:Akap9 UTSW 5 3961013 missense probably damaging 1.00
R4749:Akap9 UTSW 5 3968737 missense probably benign 0.41
R4756:Akap9 UTSW 5 4001418 missense probably damaging 0.99
R4757:Akap9 UTSW 5 4008382 missense probably damaging 1.00
R4860:Akap9 UTSW 5 4034916 intron probably benign
R4937:Akap9 UTSW 5 4050145 splice site probably null
R4960:Akap9 UTSW 5 3957664 missense probably benign 0.15
R4974:Akap9 UTSW 5 3961466 missense possibly damaging 0.81
R5101:Akap9 UTSW 5 4001748 missense probably damaging 0.96
R5160:Akap9 UTSW 5 4030007 missense probably damaging 1.00
R5200:Akap9 UTSW 5 3960734 missense probably benign 0.00
R5245:Akap9 UTSW 5 3976209 missense probably damaging 0.99
R5293:Akap9 UTSW 5 3948687 missense probably damaging 0.99
R5408:Akap9 UTSW 5 4058458 missense possibly damaging 0.84
R5507:Akap9 UTSW 5 3968683 missense probably benign 0.41
R5517:Akap9 UTSW 5 4001665 missense possibly damaging 0.76
R5579:Akap9 UTSW 5 4064714 missense possibly damaging 0.93
R5619:Akap9 UTSW 5 3954760 intron probably benign
R5645:Akap9 UTSW 5 4050590 missense probably benign 0.09
R5669:Akap9 UTSW 5 4050540 nonsense probably null
R5686:Akap9 UTSW 5 3971926 missense probably benign 0.00
R5697:Akap9 UTSW 5 3960170 missense possibly damaging 0.92
R5821:Akap9 UTSW 5 4046064 missense probably benign 0.13
R5875:Akap9 UTSW 5 4077285 missense probably benign 0.01
R5897:Akap9 UTSW 5 4077904 missense probably benign 0.23
R5999:Akap9 UTSW 5 4043925 missense probably damaging 1.00
R6025:Akap9 UTSW 5 4032801 missense probably damaging 1.00
R6078:Akap9 UTSW 5 4067924 critical splice donor site probably null
R6138:Akap9 UTSW 5 4067924 critical splice donor site probably null
R6225:Akap9 UTSW 5 3962105 missense probably damaging 1.00
R6243:Akap9 UTSW 5 4065000 intron probably null
R6326:Akap9 UTSW 5 3962061 missense probably damaging 1.00
R6564:Akap9 UTSW 5 4028491 missense probably damaging 0.98
R6617:Akap9 UTSW 5 3968745 missense probably benign 0.04
R6625:Akap9 UTSW 5 3968745 missense probably benign 0.04
R6632:Akap9 UTSW 5 4013842 splice site probably null
R6677:Akap9 UTSW 5 4029869 missense probably benign 0.21
R6717:Akap9 UTSW 5 4064086 missense probably damaging 1.00
R6893:Akap9 UTSW 5 3961709 missense probably benign 0.32
R6915:Akap9 UTSW 5 3960551 missense probably benign 0.03
R6938:Akap9 UTSW 5 4046628 missense possibly damaging 0.91
R6972:Akap9 UTSW 5 4046699 missense possibly damaging 0.62
R6973:Akap9 UTSW 5 4046699 missense possibly damaging 0.62
R6993:Akap9 UTSW 5 4065866 missense possibly damaging 0.65
R7032:Akap9 UTSW 5 3954896 missense probably benign
R7164:Akap9 UTSW 5 4060364 missense probably damaging 0.96
R7170:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7192:Akap9 UTSW 5 4005723 intron probably null
R7284:Akap9 UTSW 5 3956246 missense probably damaging 1.00
R7299:Akap9 UTSW 5 4032696 missense probably damaging 1.00
R7313:Akap9 UTSW 5 4004933 missense probably damaging 1.00
R7326:Akap9 UTSW 5 4045930 missense possibly damaging 0.47
R7343:Akap9 UTSW 5 4046364 missense probably damaging 0.99
R7455:Akap9 UTSW 5 3972792 missense probably benign 0.03
R7482:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7489:Akap9 UTSW 5 4004933 missense probably damaging 1.00
U15987:Akap9 UTSW 5 4067924 critical splice donor site probably null
X0026:Akap9 UTSW 5 4014039 missense probably damaging 1.00
X0057:Akap9 UTSW 5 3975598 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGGTAACGAGCAACCTGCTAATAAACAG -3'
(R):5'- GGCCCATCAGAGGGCACATC -3'

Sequencing Primer
(F):5'- GCAACCTGCTAATAAACAGCTACAG -3'
(R):5'- TAAGAGCCTACAGGTGTAGTTTAG -3'
Posted On2014-05-14