Incidental Mutation 'R1720:Fuz'
ID191374
Institutional Source Beutler Lab
Gene Symbol Fuz
Ensembl Gene ENSMUSG00000011658
Gene Namefuzzy planar cell polarity protein
Synonyms
MMRRC Submission 039752-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R1720 (G1)
Quality Score182
Status Not validated
Chromosome7
Chromosomal Location44896079-44902631 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 44896991 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 104 (G104W)
Ref Sequence ENSEMBL: ENSMUSP00000146434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003049] [ENSMUST00000071207] [ENSMUST00000085399] [ENSMUST00000107857] [ENSMUST00000166972] [ENSMUST00000167930] [ENSMUST00000207069] [ENSMUST00000207154] [ENSMUST00000207278] [ENSMUST00000207485] [ENSMUST00000207654] [ENSMUST00000207788] [ENSMUST00000207939] [ENSMUST00000208179] [ENSMUST00000208253] [ENSMUST00000208551] [ENSMUST00000208556] [ENSMUST00000208600] [ENSMUST00000209039] [ENSMUST00000209132] [ENSMUST00000209163]
Predicted Effect probably benign
Transcript: ENSMUST00000003049
SMART Domains Protein: ENSMUSP00000003049
Gene: ENSMUSG00000002968

DomainStartEndE-ValueType
VWA 15 178 6.55e0 SMART
low complexity region 193 211 N/A INTRINSIC
Pfam:Med25_SD1 228 383 5.8e-55 PFAM
Pfam:Med25 396 546 3.9e-64 PFAM
low complexity region 577 592 N/A INTRINSIC
low complexity region 596 632 N/A INTRINSIC
Pfam:Med25_NR-box 657 745 5.3e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000071207
AA Change: G104W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071194
Gene: ENSMUSG00000011658
AA Change: G104W

DomainStartEndE-ValueType
low complexity region 234 259 N/A INTRINSIC
low complexity region 292 310 N/A INTRINSIC
low complexity region 382 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085399
SMART Domains Protein: ENSMUSP00000082519
Gene: ENSMUSG00000060279

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7.5e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 699 741 N/A INTRINSIC
Alpha_adaptinC2 745 858 4.49e-23 SMART
Pfam:Alpha_adaptin_C 864 972 9.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107857
SMART Domains Protein: ENSMUSP00000103489
Gene: ENSMUSG00000060279

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Alpha_adaptinC2 723 836 4.49e-23 SMART
Pfam:Alpha_adaptin_C 842 950 9.1e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166972
SMART Domains Protein: ENSMUSP00000127842
Gene: ENSMUSG00000060279

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 2e-149 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 699 741 N/A INTRINSIC
Alpha_adaptinC2 745 858 4.49e-23 SMART
Pfam:Alpha_adaptin_C 864 972 5.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167930
SMART Domains Protein: ENSMUSP00000127497
Gene: ENSMUSG00000060279

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Alpha_adaptinC2 723 836 4.49e-23 SMART
Pfam:Alpha_adaptin_C 842 950 9.1e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207069
Predicted Effect probably benign
Transcript: ENSMUST00000207154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207196
Predicted Effect probably benign
Transcript: ENSMUST00000207278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207480
Predicted Effect probably benign
Transcript: ENSMUST00000207485
Predicted Effect probably benign
Transcript: ENSMUST00000207654
Predicted Effect probably benign
Transcript: ENSMUST00000207788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207833
Predicted Effect probably damaging
Transcript: ENSMUST00000207939
AA Change: G61W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000208179
AA Change: G104W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208291
Predicted Effect probably benign
Transcript: ENSMUST00000208472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208484
Predicted Effect probably benign
Transcript: ENSMUST00000208551
Predicted Effect probably benign
Transcript: ENSMUST00000208556
Predicted Effect probably damaging
Transcript: ENSMUST00000208600
AA Change: G104W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000208908
Predicted Effect probably damaging
Transcript: ENSMUST00000209039
AA Change: G104W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209067
Predicted Effect probably damaging
Transcript: ENSMUST00000209132
AA Change: G104W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000209163
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a planar cell polarity protein that is involved in ciliogenesis and directional cell movement. Knockout studies in mice exhibit neural tube defects and defective cilia, and mutations in this gene are associated with neural tube defects in humans. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit neural tube closure defects, abnormal craniofacial morphology, abnormal skeletal morphology, polydactyly, anopthalmia, pulmonary hopyplasia, and cardiac outflow tract defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A G 11: 97,771,609 F146L probably damaging Het
9330182L06Rik T G 5: 9,428,407 C424G probably damaging Het
Acot5 A G 12: 84,075,881 D413G probably benign Het
Actr5 G T 2: 158,636,137 V476F possibly damaging Het
Adhfe1 G A 1: 9,566,900 D426N probably benign Het
Adra1a T C 14: 66,638,278 L234P probably damaging Het
Akap9 G T 5: 3,972,791 V1207L possibly damaging Het
Anapc2 A G 2: 25,274,712 D36G probably benign Het
Apol8 A G 15: 77,749,366 S337P possibly damaging Het
Asxl3 A T 18: 22,452,435 D139V probably damaging Het
Atp13a4 A T 16: 29,408,928 V1037E probably damaging Het
Baat A T 4: 49,490,231 F284L probably benign Het
C1qtnf6 A T 15: 78,527,440 F40Y probably damaging Het
Caskin2 G A 11: 115,802,782 H508Y probably damaging Het
Cass4 A T 2: 172,427,734 I579F probably damaging Het
Cdk15 A G 1: 59,289,758 Y277C probably damaging Het
Cit G A 5: 115,967,897 D947N probably damaging Het
Clint1 T A 11: 45,887,410 I126K probably damaging Het
Col6a4 C T 9: 106,026,472 G1640E probably damaging Het
Ddx10 T C 9: 53,238,071 K119E probably damaging Het
Dennd1a G A 2: 37,800,197 Q964* probably null Het
Dnhd1 T C 7: 105,693,828 F1460L probably benign Het
Edc3 T C 9: 57,748,179 probably null Het
Edn1 A G 13: 42,305,350 E163G probably benign Het
Efl1 A T 7: 82,683,721 D317V possibly damaging Het
F2 A T 2: 91,628,830 Y430* probably null Het
Faap100 C T 11: 120,374,581 V490M probably damaging Het
Greb1l C A 18: 10,553,848 H1616Q probably benign Het
Grm1 G T 10: 10,746,794 probably null Het
Gucy2d G T 7: 98,477,230 A1098S probably benign Het
H1f0 T A 15: 79,028,995 S92T possibly damaging Het
Hbb-bt T A 7: 103,813,876 probably benign Het
Heg1 G A 16: 33,707,179 A170T probably benign Het
Hspa4l A T 3: 40,781,617 K578* probably null Het
Ikbke A G 1: 131,259,210 S582P possibly damaging Het
Itga6 T A 2: 71,820,166 F185L probably damaging Het
Itgal T A 7: 127,306,927 D396E probably benign Het
Kif5b T C 18: 6,213,427 H687R probably benign Het
Kmt2c T C 5: 25,299,184 N3709D probably benign Het
Lipf A T 19: 33,965,666 K125* probably null Het
Lrif1 A T 3: 106,733,136 E512D probably damaging Het
Matn2 T A 15: 34,345,274 Y142* probably null Het
Med13l A G 5: 118,741,995 T1051A probably damaging Het
Mpp3 T A 11: 102,025,756 M1L possibly damaging Het
Mro C T 18: 73,876,735 S159L probably benign Het
Myh15 T A 16: 49,092,782 D367E probably damaging Het
Myo1g T C 11: 6,512,490 Q547R probably benign Het
Neb T C 2: 52,207,721 I902M probably benign Het
Nsd1 G A 13: 55,246,898 D771N probably damaging Het
Olfr1507 A C 14: 52,490,594 Y40* probably null Het
Olfr248 A G 1: 174,391,920 I284V probably benign Het
Olfr294 T C 7: 86,616,456 N63S probably damaging Het
Olfr434 T C 6: 43,217,560 S216P probably damaging Het
Olfr912 C T 9: 38,581,289 T4I probably benign Het
Penk A G 4: 4,134,240 Y136H probably damaging Het
Prdm6 C T 18: 53,540,200 S144L probably benign Het
Ptprq T A 10: 107,686,294 I599F probably damaging Het
Racgap1 A T 15: 99,628,769 C304* probably null Het
Rbp3 T C 14: 33,956,909 V938A probably benign Het
Rpp30 A G 19: 36,094,427 K132E probably damaging Het
Rxfp2 A T 5: 150,043,099 R101* probably null Het
Ryr1 A T 7: 29,101,870 V823E probably damaging Het
S100pbp A T 4: 129,182,093 D146E probably damaging Het
Sdr9c7 T A 10: 127,902,258 V135E probably damaging Het
Serpinb12 A G 1: 106,946,614 D23G probably damaging Het
Serpinf1 T A 11: 75,413,981 T185S probably null Het
Slc23a1 A C 18: 35,625,851 C96G possibly damaging Het
Slc5a4a C T 10: 76,189,269 probably null Het
Suco A T 1: 161,834,054 L936Q probably damaging Het
Tmem144 T C 3: 79,825,299 Y224C probably damaging Het
Tpm4 T A 8: 72,144,754 probably null Het
Ttn T C 2: 76,730,070 E29329G probably damaging Het
Txn1 T C 4: 57,943,922 I101V probably benign Het
Ube2o A T 11: 116,544,607 C452S probably benign Het
Uhrf1bp1l T C 10: 89,782,586 V141A probably damaging Het
Uxs1 A T 1: 43,764,921 I278N probably damaging Het
Vps54 T C 11: 21,306,519 F663L probably damaging Het
Wdfy3 CG C 5: 101,926,525 probably null Het
Zc3h11a A G 1: 133,621,701 S741P probably damaging Het
Zdbf2 G A 1: 63,303,277 V272I possibly damaging Het
Zdhhc24 A G 19: 4,878,951 N68S probably damaging Het
Znfx1 A T 2: 167,044,066 L858* probably null Het
Other mutations in Fuz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01918:Fuz APN 7 44896959 missense probably damaging 1.00
R0211:Fuz UTSW 7 44899022 unclassified probably null
R0586:Fuz UTSW 7 44898558 missense possibly damaging 0.59
R1028:Fuz UTSW 7 44896926 missense probably damaging 1.00
R4969:Fuz UTSW 7 44900294 missense probably damaging 1.00
R5278:Fuz UTSW 7 44896277 missense probably benign 0.11
R5870:Fuz UTSW 7 44900318 missense probably damaging 1.00
R6972:Fuz UTSW 7 44897331 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- TTCCCAGCAGAATGTAGCCAGCAG -3'
(R):5'- GTCAGCTCCTCAAGTCCCACAATG -3'

Sequencing Primer
(F):5'- ATGTAGCCAGCAGCATAGG -3'
(R):5'- GGTCCTTAATAGGATCTAGTCAGAG -3'
Posted On2014-05-14