Incidental Mutation 'R1720:Itgal'
ID191380
Institutional Source Beutler Lab
Gene Symbol Itgal
Ensembl Gene ENSMUSG00000030830
Gene Nameintegrin alpha L
SynonymsLFA-1, Ly-21, Cd11a, Ly-15
MMRRC Submission 039752-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R1720 (G1)
Quality Score220
Status Not validated
Chromosome7
Chromosomal Location127296260-127335138 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127306927 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 396 (D396E)
Ref Sequence ENSEMBL: ENSMUSP00000131847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106306] [ENSMUST00000117762] [ENSMUST00000118405] [ENSMUST00000120857] [ENSMUST00000170971]
Predicted Effect probably benign
Transcript: ENSMUST00000106306
AA Change: D396E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101913
Gene: ENSMUSG00000030830
AA Change: D396E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1043 1059 N/A INTRINSIC
transmembrane domain 1087 1109 N/A INTRINSIC
Pfam:Integrin_alpha 1110 1124 5.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117762
AA Change: D396E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113946
Gene: ENSMUSG00000030830
AA Change: D396E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1042 1058 N/A INTRINSIC
transmembrane domain 1086 1108 N/A INTRINSIC
Pfam:Integrin_alpha 1109 1123 5.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118405
SMART Domains Protein: ENSMUSP00000112591
Gene: ENSMUSG00000030830

DomainStartEndE-ValueType
Int_alpha 2 54 4.21e-3 SMART
Int_alpha 58 113 9.6e-7 SMART
Int_alpha 119 172 3.58e-15 SMART
Int_alpha 179 228 1.28e1 SMART
low complexity region 646 662 N/A INTRINSIC
transmembrane domain 690 712 N/A INTRINSIC
Pfam:Integrin_alpha 713 727 2.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120857
AA Change: D396E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113396
Gene: ENSMUSG00000030830
AA Change: D396E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1042 1058 N/A INTRINSIC
transmembrane domain 1086 1108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170971
AA Change: D396E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131847
Gene: ENSMUSG00000030830
AA Change: D396E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1042 1058 N/A INTRINSIC
transmembrane domain 1086 1108 N/A INTRINSIC
Pfam:Integrin_alpha 1109 1123 1.2e-6 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ITGAL encodes the integrin alpha L chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form the integrin lymphocyte function-associated antigen-1 (LFA-1), which is expressed on all leukocytes. LFA-1 plays a central role in leukocyte intercellular adhesion through interactions with its ligands, ICAMs 1-3 (intercellular adhesion molecules 1 through 3), and also functions in lymphocyte costimulatory signaling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mutations of this gene lead to increased leukocyte cell number, alter T cell activation, leukocyte migration and adhesion, spleen and lymph node morphology, and may affect humoral immune responses, metastatic potential, and susceptibility to endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A G 11: 97,771,609 F146L probably damaging Het
9330182L06Rik T G 5: 9,428,407 C424G probably damaging Het
Acot5 A G 12: 84,075,881 D413G probably benign Het
Actr5 G T 2: 158,636,137 V476F possibly damaging Het
Adhfe1 G A 1: 9,566,900 D426N probably benign Het
Adra1a T C 14: 66,638,278 L234P probably damaging Het
Akap9 G T 5: 3,972,791 V1207L possibly damaging Het
Anapc2 A G 2: 25,274,712 D36G probably benign Het
Apol8 A G 15: 77,749,366 S337P possibly damaging Het
Asxl3 A T 18: 22,452,435 D139V probably damaging Het
Atp13a4 A T 16: 29,408,928 V1037E probably damaging Het
Baat A T 4: 49,490,231 F284L probably benign Het
C1qtnf6 A T 15: 78,527,440 F40Y probably damaging Het
Caskin2 G A 11: 115,802,782 H508Y probably damaging Het
Cass4 A T 2: 172,427,734 I579F probably damaging Het
Cdk15 A G 1: 59,289,758 Y277C probably damaging Het
Cit G A 5: 115,967,897 D947N probably damaging Het
Clint1 T A 11: 45,887,410 I126K probably damaging Het
Col6a4 C T 9: 106,026,472 G1640E probably damaging Het
Ddx10 T C 9: 53,238,071 K119E probably damaging Het
Dennd1a G A 2: 37,800,197 Q964* probably null Het
Dnhd1 T C 7: 105,693,828 F1460L probably benign Het
Edc3 T C 9: 57,748,179 probably null Het
Edn1 A G 13: 42,305,350 E163G probably benign Het
Efl1 A T 7: 82,683,721 D317V possibly damaging Het
F2 A T 2: 91,628,830 Y430* probably null Het
Faap100 C T 11: 120,374,581 V490M probably damaging Het
Fuz G T 7: 44,896,991 G104W probably damaging Het
Greb1l C A 18: 10,553,848 H1616Q probably benign Het
Grm1 G T 10: 10,746,794 probably null Het
Gucy2d G T 7: 98,477,230 A1098S probably benign Het
H1f0 T A 15: 79,028,995 S92T possibly damaging Het
Hbb-bt T A 7: 103,813,876 probably benign Het
Heg1 G A 16: 33,707,179 A170T probably benign Het
Hspa4l A T 3: 40,781,617 K578* probably null Het
Ikbke A G 1: 131,259,210 S582P possibly damaging Het
Itga6 T A 2: 71,820,166 F185L probably damaging Het
Kif5b T C 18: 6,213,427 H687R probably benign Het
Kmt2c T C 5: 25,299,184 N3709D probably benign Het
Lipf A T 19: 33,965,666 K125* probably null Het
Lrif1 A T 3: 106,733,136 E512D probably damaging Het
Matn2 T A 15: 34,345,274 Y142* probably null Het
Med13l A G 5: 118,741,995 T1051A probably damaging Het
Mpp3 T A 11: 102,025,756 M1L possibly damaging Het
Mro C T 18: 73,876,735 S159L probably benign Het
Myh15 T A 16: 49,092,782 D367E probably damaging Het
Myo1g T C 11: 6,512,490 Q547R probably benign Het
Neb T C 2: 52,207,721 I902M probably benign Het
Nsd1 G A 13: 55,246,898 D771N probably damaging Het
Olfr1507 A C 14: 52,490,594 Y40* probably null Het
Olfr248 A G 1: 174,391,920 I284V probably benign Het
Olfr294 T C 7: 86,616,456 N63S probably damaging Het
Olfr434 T C 6: 43,217,560 S216P probably damaging Het
Olfr912 C T 9: 38,581,289 T4I probably benign Het
Penk A G 4: 4,134,240 Y136H probably damaging Het
Prdm6 C T 18: 53,540,200 S144L probably benign Het
Ptprq T A 10: 107,686,294 I599F probably damaging Het
Racgap1 A T 15: 99,628,769 C304* probably null Het
Rbp3 T C 14: 33,956,909 V938A probably benign Het
Rpp30 A G 19: 36,094,427 K132E probably damaging Het
Rxfp2 A T 5: 150,043,099 R101* probably null Het
Ryr1 A T 7: 29,101,870 V823E probably damaging Het
S100pbp A T 4: 129,182,093 D146E probably damaging Het
Sdr9c7 T A 10: 127,902,258 V135E probably damaging Het
Serpinb12 A G 1: 106,946,614 D23G probably damaging Het
Serpinf1 T A 11: 75,413,981 T185S probably null Het
Slc23a1 A C 18: 35,625,851 C96G possibly damaging Het
Slc5a4a C T 10: 76,189,269 probably null Het
Suco A T 1: 161,834,054 L936Q probably damaging Het
Tmem144 T C 3: 79,825,299 Y224C probably damaging Het
Tpm4 T A 8: 72,144,754 probably null Het
Ttn T C 2: 76,730,070 E29329G probably damaging Het
Txn1 T C 4: 57,943,922 I101V probably benign Het
Ube2o A T 11: 116,544,607 C452S probably benign Het
Uhrf1bp1l T C 10: 89,782,586 V141A probably damaging Het
Uxs1 A T 1: 43,764,921 I278N probably damaging Het
Vps54 T C 11: 21,306,519 F663L probably damaging Het
Wdfy3 CG C 5: 101,926,525 probably null Het
Zc3h11a A G 1: 133,621,701 S741P probably damaging Het
Zdbf2 G A 1: 63,303,277 V272I possibly damaging Het
Zdhhc24 A G 19: 4,878,951 N68S probably damaging Het
Znfx1 A T 2: 167,044,066 L858* probably null Het
Other mutations in Itgal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Itgal APN 7 127302011 missense probably damaging 0.99
IGL01300:Itgal APN 7 127314118 missense probably damaging 1.00
IGL01345:Itgal APN 7 127300956 missense possibly damaging 0.56
IGL01826:Itgal APN 7 127302146 missense probably benign 0.16
IGL02202:Itgal APN 7 127330179 nonsense probably null
IGL02212:Itgal APN 7 127300980 missense probably benign 0.00
IGL02513:Itgal APN 7 127328672 missense possibly damaging 0.78
IGL02608:Itgal APN 7 127310244 missense probably damaging 1.00
IGL02946:Itgal APN 7 127314368 missense probably damaging 0.99
sunglow UTSW 7 127328747 missense probably null 0.89
R0069:Itgal UTSW 7 127310331 missense probably benign 0.44
R0069:Itgal UTSW 7 127310331 missense probably benign 0.44
R0107:Itgal UTSW 7 127328559 splice site probably benign
R0331:Itgal UTSW 7 127306681 unclassified probably null
R0350:Itgal UTSW 7 127322081 missense probably damaging 1.00
R0380:Itgal UTSW 7 127310751 nonsense probably null
R0537:Itgal UTSW 7 127311273 missense possibly damaging 0.61
R0546:Itgal UTSW 7 127310314 missense probably benign 0.00
R0594:Itgal UTSW 7 127314060 missense probably damaging 1.00
R1167:Itgal UTSW 7 127300939 missense probably damaging 1.00
R1377:Itgal UTSW 7 127321917 missense probably damaging 1.00
R1575:Itgal UTSW 7 127300888 critical splice acceptor site probably null
R1690:Itgal UTSW 7 127302117 missense possibly damaging 0.56
R1693:Itgal UTSW 7 127305281 missense probably damaging 1.00
R1702:Itgal UTSW 7 127305025 missense probably benign 0.00
R1774:Itgal UTSW 7 127309622 critical splice donor site probably null
R1824:Itgal UTSW 7 127314060 missense probably damaging 1.00
R1878:Itgal UTSW 7 127310671 missense probably benign 0.44
R1951:Itgal UTSW 7 127330145 missense probably damaging 1.00
R2265:Itgal UTSW 7 127306701 missense possibly damaging 0.63
R2267:Itgal UTSW 7 127306701 missense possibly damaging 0.63
R2269:Itgal UTSW 7 127306701 missense possibly damaging 0.63
R2276:Itgal UTSW 7 127328747 missense probably null 0.89
R2570:Itgal UTSW 7 127314096 missense probably damaging 1.00
R3925:Itgal UTSW 7 127324537 splice site probably benign
R4225:Itgal UTSW 7 127305312 missense probably damaging 1.00
R4377:Itgal UTSW 7 127328281 missense probably benign 0.00
R4466:Itgal UTSW 7 127328512 missense possibly damaging 0.93
R4579:Itgal UTSW 7 127305294 missense possibly damaging 0.83
R4656:Itgal UTSW 7 127322553 missense probably damaging 1.00
R4771:Itgal UTSW 7 127328233 missense probably damaging 1.00
R5012:Itgal UTSW 7 127299630 critical splice donor site probably null
R5328:Itgal UTSW 7 127311675 critical splice donor site probably null
R5365:Itgal UTSW 7 127305350 missense probably damaging 0.98
R5579:Itgal UTSW 7 127306929 missense probably benign 0.10
R5849:Itgal UTSW 7 127317320 missense probably benign 0.27
R5955:Itgal UTSW 7 127304989 missense possibly damaging 0.82
R6254:Itgal UTSW 7 127325203 missense probably damaging 1.00
R6269:Itgal UTSW 7 127330217 missense probably null 1.00
R6520:Itgal UTSW 7 127330331 missense probably benign 0.01
R6541:Itgal UTSW 7 127311562 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATAGCACTCACCCTAGTCCTCTCC -3'
(R):5'- tcgccatgcctagATGAAAAGAATCC -3'

Sequencing Primer
(F):5'- CCTTCCCTGAGCAGGGC -3'
(R):5'- ACAGGTTTGAGCTACTCTCTGG -3'
Posted On2014-05-14