Incidental Mutation 'R1720:Mro'
ID191426
Institutional Source Beutler Lab
Gene Symbol Mro
Ensembl Gene ENSMUSG00000064036
Gene Namemaestro
Synonyms
MMRRC Submission 039752-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R1720 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location73859385-73881333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 73876735 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 159 (S159L)
Ref Sequence ENSEMBL: ENSMUSP00000136775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119239] [ENSMUST00000120033] [ENSMUST00000134847] [ENSMUST00000179472]
Predicted Effect probably benign
Transcript: ENSMUST00000119239
AA Change: S158L

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113392
Gene: ENSMUSG00000064036
AA Change: S158L

DomainStartEndE-ValueType
SCOP:d1gw5a_ 23 239 9e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120033
AA Change: S159L

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113434
Gene: ENSMUSG00000064036
AA Change: S159L

DomainStartEndE-ValueType
SCOP:d1gw5a_ 23 240 3e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136473
Predicted Effect probably benign
Transcript: ENSMUST00000179472
AA Change: S159L

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000136775
Gene: ENSMUSG00000064036
AA Change: S159L

DomainStartEndE-ValueType
SCOP:d1gw5a_ 23 240 3e-10 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is specifically transcribed in males before and after differentiation of testis, and the encoded protein may play an important role in a mammalian sex determination. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal reproductive morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A G 11: 97,771,609 F146L probably damaging Het
9330182L06Rik T G 5: 9,428,407 C424G probably damaging Het
Acot5 A G 12: 84,075,881 D413G probably benign Het
Actr5 G T 2: 158,636,137 V476F possibly damaging Het
Adhfe1 G A 1: 9,566,900 D426N probably benign Het
Adra1a T C 14: 66,638,278 L234P probably damaging Het
Akap9 G T 5: 3,972,791 V1207L possibly damaging Het
Anapc2 A G 2: 25,274,712 D36G probably benign Het
Apol8 A G 15: 77,749,366 S337P possibly damaging Het
Asxl3 A T 18: 22,452,435 D139V probably damaging Het
Atp13a4 A T 16: 29,408,928 V1037E probably damaging Het
Baat A T 4: 49,490,231 F284L probably benign Het
C1qtnf6 A T 15: 78,527,440 F40Y probably damaging Het
Caskin2 G A 11: 115,802,782 H508Y probably damaging Het
Cass4 A T 2: 172,427,734 I579F probably damaging Het
Cdk15 A G 1: 59,289,758 Y277C probably damaging Het
Cit G A 5: 115,967,897 D947N probably damaging Het
Clint1 T A 11: 45,887,410 I126K probably damaging Het
Col6a4 C T 9: 106,026,472 G1640E probably damaging Het
Ddx10 T C 9: 53,238,071 K119E probably damaging Het
Dennd1a G A 2: 37,800,197 Q964* probably null Het
Dnhd1 T C 7: 105,693,828 F1460L probably benign Het
Edc3 T C 9: 57,748,179 probably null Het
Edn1 A G 13: 42,305,350 E163G probably benign Het
Efl1 A T 7: 82,683,721 D317V possibly damaging Het
F2 A T 2: 91,628,830 Y430* probably null Het
Faap100 C T 11: 120,374,581 V490M probably damaging Het
Fuz G T 7: 44,896,991 G104W probably damaging Het
Greb1l C A 18: 10,553,848 H1616Q probably benign Het
Grm1 G T 10: 10,746,794 probably null Het
Gucy2d G T 7: 98,477,230 A1098S probably benign Het
H1f0 T A 15: 79,028,995 S92T possibly damaging Het
Hbb-bt T A 7: 103,813,876 probably benign Het
Heg1 G A 16: 33,707,179 A170T probably benign Het
Hspa4l A T 3: 40,781,617 K578* probably null Het
Ikbke A G 1: 131,259,210 S582P possibly damaging Het
Itga6 T A 2: 71,820,166 F185L probably damaging Het
Itgal T A 7: 127,306,927 D396E probably benign Het
Kif5b T C 18: 6,213,427 H687R probably benign Het
Kmt2c T C 5: 25,299,184 N3709D probably benign Het
Lipf A T 19: 33,965,666 K125* probably null Het
Lrif1 A T 3: 106,733,136 E512D probably damaging Het
Matn2 T A 15: 34,345,274 Y142* probably null Het
Med13l A G 5: 118,741,995 T1051A probably damaging Het
Mpp3 T A 11: 102,025,756 M1L possibly damaging Het
Myh15 T A 16: 49,092,782 D367E probably damaging Het
Myo1g T C 11: 6,512,490 Q547R probably benign Het
Neb T C 2: 52,207,721 I902M probably benign Het
Nsd1 G A 13: 55,246,898 D771N probably damaging Het
Olfr1507 A C 14: 52,490,594 Y40* probably null Het
Olfr248 A G 1: 174,391,920 I284V probably benign Het
Olfr294 T C 7: 86,616,456 N63S probably damaging Het
Olfr434 T C 6: 43,217,560 S216P probably damaging Het
Olfr912 C T 9: 38,581,289 T4I probably benign Het
Penk A G 4: 4,134,240 Y136H probably damaging Het
Prdm6 C T 18: 53,540,200 S144L probably benign Het
Ptprq T A 10: 107,686,294 I599F probably damaging Het
Racgap1 A T 15: 99,628,769 C304* probably null Het
Rbp3 T C 14: 33,956,909 V938A probably benign Het
Rpp30 A G 19: 36,094,427 K132E probably damaging Het
Rxfp2 A T 5: 150,043,099 R101* probably null Het
Ryr1 A T 7: 29,101,870 V823E probably damaging Het
S100pbp A T 4: 129,182,093 D146E probably damaging Het
Sdr9c7 T A 10: 127,902,258 V135E probably damaging Het
Serpinb12 A G 1: 106,946,614 D23G probably damaging Het
Serpinf1 T A 11: 75,413,981 T185S probably null Het
Slc23a1 A C 18: 35,625,851 C96G possibly damaging Het
Slc5a4a C T 10: 76,189,269 probably null Het
Suco A T 1: 161,834,054 L936Q probably damaging Het
Tmem144 T C 3: 79,825,299 Y224C probably damaging Het
Tpm4 T A 8: 72,144,754 probably null Het
Ttn T C 2: 76,730,070 E29329G probably damaging Het
Txn1 T C 4: 57,943,922 I101V probably benign Het
Ube2o A T 11: 116,544,607 C452S probably benign Het
Uhrf1bp1l T C 10: 89,782,586 V141A probably damaging Het
Uxs1 A T 1: 43,764,921 I278N probably damaging Het
Vps54 T C 11: 21,306,519 F663L probably damaging Het
Wdfy3 CG C 5: 101,926,525 probably null Het
Zc3h11a A G 1: 133,621,701 S741P probably damaging Het
Zdbf2 G A 1: 63,303,277 V272I possibly damaging Het
Zdhhc24 A G 19: 4,878,951 N68S probably damaging Het
Znfx1 A T 2: 167,044,066 L858* probably null Het
Other mutations in Mro
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0471:Mro UTSW 18 73876789 missense probably benign 0.04
R1671:Mro UTSW 18 73870055 splice site probably benign
R2267:Mro UTSW 18 73873297 missense probably benign 0.19
R4691:Mro UTSW 18 73873326 missense probably benign
R5382:Mro UTSW 18 73876822 missense probably benign 0.00
R6178:Mro UTSW 18 73873224 missense possibly damaging 0.62
R6427:Mro UTSW 18 73872033 missense probably damaging 1.00
R6833:Mro UTSW 18 73863932 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TTTAGGCGATGTCAGGAAGCAGC -3'
(R):5'- ACGGCCATTCTAACTGGCAGGAAC -3'

Sequencing Primer
(F):5'- TCAAGGTGTCTAAGGCCAGC -3'
(R):5'- GGCCTGGCTTCTCCACTTAG -3'
Posted On2014-05-14