Incidental Mutation 'R1721:Pnisr'
ID191446
Institutional Source Beutler Lab
Gene Symbol Pnisr
Ensembl Gene ENSMUSG00000028248
Gene NamePNN interacting serine/arginine-rich
SynonymsSfrs18, 5730406M06Rik
MMRRC Submission 039753-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R1721 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location21847583-21876475 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 21874086 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029911] [ENSMUST00000098238] [ENSMUST00000108229] [ENSMUST00000185001]
Predicted Effect unknown
Transcript: ENSMUST00000029911
AA Change: R610W
SMART Domains Protein: ENSMUSP00000029911
Gene: ENSMUSG00000028248
AA Change: R610W

DomainStartEndE-ValueType
low complexity region 1 27 N/A INTRINSIC
internal_repeat_1 57 86 6.59e-5 PROSPERO
low complexity region 94 117 N/A INTRINSIC
internal_repeat_1 121 149 6.59e-5 PROSPERO
low complexity region 181 194 N/A INTRINSIC
Pfam:PNISR 223 391 1.1e-55 PFAM
low complexity region 429 449 N/A INTRINSIC
low complexity region 494 586 N/A INTRINSIC
low complexity region 592 640 N/A INTRINSIC
low complexity region 664 703 N/A INTRINSIC
low complexity region 746 783 N/A INTRINSIC
low complexity region 789 814 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000098238
AA Change: R610W
SMART Domains Protein: ENSMUSP00000095840
Gene: ENSMUSG00000028248
AA Change: R610W

DomainStartEndE-ValueType
low complexity region 1 27 N/A INTRINSIC
internal_repeat_1 57 86 7.37e-5 PROSPERO
low complexity region 94 117 N/A INTRINSIC
internal_repeat_1 121 149 7.37e-5 PROSPERO
low complexity region 181 194 N/A INTRINSIC
coiled coil region 240 276 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
low complexity region 376 415 N/A INTRINSIC
low complexity region 429 449 N/A INTRINSIC
low complexity region 494 586 N/A INTRINSIC
low complexity region 592 640 N/A INTRINSIC
low complexity region 664 703 N/A INTRINSIC
low complexity region 746 783 N/A INTRINSIC
low complexity region 789 805 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108229
SMART Domains Protein: ENSMUSP00000103864
Gene: ENSMUSG00000028248

DomainStartEndE-ValueType
low complexity region 1 27 N/A INTRINSIC
low complexity region 94 117 N/A INTRINSIC
low complexity region 181 194 N/A INTRINSIC
coiled coil region 240 276 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133241
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148561
Predicted Effect probably benign
Transcript: ENSMUST00000185001
SMART Domains Protein: ENSMUSP00000139324
Gene: ENSMUSG00000028248

DomainStartEndE-ValueType
low complexity region 1 27 N/A INTRINSIC
low complexity region 94 117 N/A INTRINSIC
low complexity region 181 194 N/A INTRINSIC
coiled coil region 240 276 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
Meta Mutation Damage Score 0.41 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 99% (87/88)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,743,598 S743T probably damaging Het
Acin1 A T 14: 54,664,538 V559E probably benign Het
Adamts20 A G 15: 94,338,459 F844L probably benign Het
Adcy5 C A 16: 35,298,424 D1048E probably damaging Het
Agrn A T 4: 156,175,173 C768* probably null Het
Aldh18a1 G T 19: 40,564,838 Q487K probably damaging Het
Aldh3b1 G A 19: 3,921,271 probably benign Het
Asb18 T G 1: 89,968,580 D246A probably benign Het
Atp2b1 T C 10: 98,996,888 V417A probably damaging Het
Bcl2l15 A G 3: 103,838,598 probably null Het
Cage1 T A 13: 38,023,333 K285* probably null Het
Cldn17 A G 16: 88,506,556 L95P probably damaging Het
Cldn20 A T 17: 3,532,882 D110V probably damaging Het
Cnot10 T C 9: 114,614,999 T443A probably benign Het
Col14a1 T A 15: 55,447,462 probably benign Het
Col23a1 T C 11: 51,527,889 Y135H unknown Het
Cse1l T C 2: 166,926,411 S210P probably damaging Het
Cspg4 T G 9: 56,888,743 V1254G probably damaging Het
Ctgf A C 10: 24,596,797 T202P probably damaging Het
Dip2c A G 13: 9,659,368 T1415A probably damaging Het
Epc2 A G 2: 49,532,105 Y337C probably damaging Het
Epha2 A G 4: 141,322,652 S799G probably damaging Het
Fndc10 A G 4: 155,694,898 Y133C probably damaging Het
Gli3 G T 13: 15,726,297 S1423I probably benign Het
Gm6034 A T 17: 36,043,153 probably benign Het
Gmip A G 8: 69,811,232 S109G probably damaging Het
Grik2 C A 10: 49,523,746 W296L possibly damaging Het
Gucy2d T A 7: 98,454,061 L504H probably damaging Het
Il6 T A 5: 30,013,492 Y46N possibly damaging Het
Ints8 C A 4: 11,241,684 C253F probably damaging Het
Itga9 A G 9: 118,698,306 probably benign Het
Kcna7 T C 7: 45,406,921 V187A possibly damaging Het
Kdm5b G T 1: 134,613,181 probably benign Het
Knl1 T G 2: 119,076,334 S1635A probably damaging Het
Lce1b A G 3: 92,656,011 S72P unknown Het
Lox T G 18: 52,520,911 probably null Het
Mdc1 A G 17: 35,847,826 D366G possibly damaging Het
Meiob T C 17: 24,834,047 C344R probably damaging Het
Mier2 A G 10: 79,548,830 V150A probably damaging Het
Mon2 A T 10: 123,031,097 M551K probably damaging Het
Mrps15 A G 4: 126,051,394 T125A probably benign Het
Mtmr14 A G 6: 113,253,732 H99R probably damaging Het
Mup4 A G 4: 59,960,598 M1T probably null Het
Mup5 G A 4: 61,832,370 R179* probably null Het
Ncoa3 T G 2: 166,069,301 V1326G possibly damaging Het
Noa1 A T 5: 77,307,581 N429K probably benign Het
Nrxn1 C T 17: 90,162,404 A241T probably damaging Het
Olfr331 C T 11: 58,501,939 V206M probably damaging Het
Olfr59 A T 11: 74,289,300 Y218F probably damaging Het
Pcdh9 G A 14: 93,888,035 S233L probably damaging Het
Peg3 C A 7: 6,709,901 S774I possibly damaging Het
Phyh A G 2: 4,937,809 K321R probably null Het
Plcg1 T A 2: 160,731,920 M35K probably damaging Het
Ppargc1b T A 18: 61,307,204 probably null Het
Prcd A C 11: 116,657,545 S27R probably benign Het
Prx T A 7: 27,517,523 M622K probably benign Het
Psmd1 T A 1: 86,071,845 D51E probably damaging Het
Psmd13 C T 7: 140,883,517 T38I probably damaging Het
Ptprf A C 4: 118,224,899 D1047E possibly damaging Het
Rai14 C A 15: 10,633,228 Q25H probably damaging Het
Riiad1 G A 3: 94,472,869 P40S possibly damaging Het
Rnft1 T A 11: 86,486,270 N53K probably benign Het
Scn4a C T 11: 106,320,820 R1457H probably benign Het
Sema6c A T 3: 95,170,788 I492F probably damaging Het
Shbg T C 11: 69,614,972 H403R probably damaging Het
Slc15a5 A T 6: 138,072,847 probably benign Het
Slc38a1 G A 15: 96,587,135 T221M probably damaging Het
Slc6a16 T A 7: 45,261,176 V375E possibly damaging Het
Slc6a17 T A 3: 107,472,176 M559L probably damaging Het
Slmap A G 14: 26,460,218 probably benign Het
Sorcs2 G A 5: 36,026,748 R965W probably damaging Het
St8sia4 C A 1: 95,653,669 R116L probably damaging Het
Tcaf1 A C 6: 42,675,338 S737A possibly damaging Het
Thbs2 T A 17: 14,678,810 Y676F probably benign Het
Tmod2 A G 9: 75,586,042 probably benign Het
Trim75 T C 8: 64,982,739 probably null Het
Ubr5 A T 15: 38,041,846 S169T probably benign Het
Usp54 A T 14: 20,583,440 Y37* probably null Het
Vill T C 9: 119,066,014 F100S probably damaging Het
Vstm5 A G 9: 15,257,367 R76G probably benign Het
Zfp608 T C 18: 54,899,249 T540A probably benign Het
Zfp947 A C 17: 22,146,203 N163K probably benign Het
Zfyve26 T C 12: 79,261,799 H228R possibly damaging Het
Other mutations in Pnisr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Pnisr APN 4 21870407 critical splice donor site probably null
IGL01467:Pnisr APN 4 21874650 unclassified probably benign
IGL01997:Pnisr APN 4 21871537 missense possibly damaging 0.95
IGL02641:Pnisr APN 4 21860908 missense probably benign 0.03
IGL02756:Pnisr APN 4 21862175 missense probably benign 0.07
R0106:Pnisr UTSW 4 21874617 unclassified probably benign
R0106:Pnisr UTSW 4 21874617 unclassified probably benign
R0620:Pnisr UTSW 4 21874092 unclassified probably benign
R0636:Pnisr UTSW 4 21873800 unclassified probably benign
R1179:Pnisr UTSW 4 21865937 missense possibly damaging 0.95
R1388:Pnisr UTSW 4 21862041 missense possibly damaging 0.88
R1450:Pnisr UTSW 4 21874912 critical splice acceptor site probably null
R1609:Pnisr UTSW 4 21871440 nonsense probably null
R1663:Pnisr UTSW 4 21873857 unclassified probably benign
R1670:Pnisr UTSW 4 21865893 missense probably damaging 1.00
R1792:Pnisr UTSW 4 21860968 missense possibly damaging 0.94
R1867:Pnisr UTSW 4 21874086 unclassified probably benign
R1868:Pnisr UTSW 4 21874086 unclassified probably benign
R1909:Pnisr UTSW 4 21869517 missense possibly damaging 0.88
R1931:Pnisr UTSW 4 21873612 missense probably benign 0.01
R4843:Pnisr UTSW 4 21857400 intron probably benign
R4917:Pnisr UTSW 4 21859330 intron probably benign
R5076:Pnisr UTSW 4 21874990 unclassified probably benign
R5164:Pnisr UTSW 4 21859237 missense possibly damaging 0.88
R5227:Pnisr UTSW 4 21874587 unclassified probably benign
R6722:Pnisr UTSW 4 21859165 missense probably damaging 0.99
Z1088:Pnisr UTSW 4 21873684 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTCATCTCCTAAGCGGAGAAAGAGAC -3'
(R):5'- TGCTCCTTCCACTAGAATCAGAACCTG -3'

Sequencing Primer
(F):5'- ACCCAGTAGGAGCAGGTCTC -3'
(R):5'- ttcttcccttttctgtttttcttttc -3'
Posted On2014-05-14