Incidental Mutation 'R1721:Tmod2'
ID191471
Institutional Source Beutler Lab
Gene Symbol Tmod2
Ensembl Gene ENSMUSG00000032186
Gene Nametropomodulin 2
SynonymsNTMOD, neural tropomodulin, N-Tmod
MMRRC Submission 039753-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1721 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location75565621-75611325 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 75586042 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064433] [ENSMUST00000098552] [ENSMUST00000164100] [ENSMUST00000215036] [ENSMUST00000215462] [ENSMUST00000215614]
Predicted Effect probably benign
Transcript: ENSMUST00000064433
SMART Domains Protein: ENSMUSP00000069956
Gene: ENSMUSG00000032186

DomainStartEndE-ValueType
Pfam:Tropomodulin 1 147 1.7e-68 PFAM
PDB:1IO0|A 163 346 1e-80 PDB
SCOP:d1yrga_ 194 291 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098552
SMART Domains Protein: ENSMUSP00000096152
Gene: ENSMUSG00000032186

DomainStartEndE-ValueType
Pfam:Tropomodulin 1 147 1.7e-68 PFAM
PDB:1IO0|A 163 346 1e-80 PDB
SCOP:d1yrga_ 194 291 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164100
SMART Domains Protein: ENSMUSP00000126739
Gene: ENSMUSG00000032186

DomainStartEndE-ValueType
Pfam:Tropomodulin 5 146 6.3e-59 PFAM
PDB:1IO0|A 163 346 1e-80 PDB
SCOP:d1yrga_ 194 291 4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214120
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214581
Predicted Effect probably benign
Transcript: ENSMUST00000215036
Predicted Effect probably benign
Transcript: ENSMUST00000215462
Predicted Effect probably benign
Transcript: ENSMUST00000215614
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a neuronal-specific member of the tropomodulin family of actin-regulatory proteins. The encoded protein caps the pointed end of actin filaments preventing both elongation and depolymerization. The capping activity of this protein is dependent on its association with tropomyosin. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutation of this gene results in enhanced LTP, hyperactivity, impaired startle response, and impaired learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,743,598 S743T probably damaging Het
Acin1 A T 14: 54,664,538 V559E probably benign Het
Adamts20 A G 15: 94,338,459 F844L probably benign Het
Adcy5 C A 16: 35,298,424 D1048E probably damaging Het
Agrn A T 4: 156,175,173 C768* probably null Het
Aldh18a1 G T 19: 40,564,838 Q487K probably damaging Het
Aldh3b1 G A 19: 3,921,271 probably benign Het
Asb18 T G 1: 89,968,580 D246A probably benign Het
Atp2b1 T C 10: 98,996,888 V417A probably damaging Het
Bcl2l15 A G 3: 103,838,598 probably null Het
Cage1 T A 13: 38,023,333 K285* probably null Het
Cldn17 A G 16: 88,506,556 L95P probably damaging Het
Cldn20 A T 17: 3,532,882 D110V probably damaging Het
Cnot10 T C 9: 114,614,999 T443A probably benign Het
Col14a1 T A 15: 55,447,462 probably benign Het
Col23a1 T C 11: 51,527,889 Y135H unknown Het
Cse1l T C 2: 166,926,411 S210P probably damaging Het
Cspg4 T G 9: 56,888,743 V1254G probably damaging Het
Ctgf A C 10: 24,596,797 T202P probably damaging Het
Dip2c A G 13: 9,659,368 T1415A probably damaging Het
Epc2 A G 2: 49,532,105 Y337C probably damaging Het
Epha2 A G 4: 141,322,652 S799G probably damaging Het
Fndc10 A G 4: 155,694,898 Y133C probably damaging Het
Gli3 G T 13: 15,726,297 S1423I probably benign Het
Gm6034 A T 17: 36,043,153 probably benign Het
Gmip A G 8: 69,811,232 S109G probably damaging Het
Grik2 C A 10: 49,523,746 W296L possibly damaging Het
Gucy2d T A 7: 98,454,061 L504H probably damaging Het
Il6 T A 5: 30,013,492 Y46N possibly damaging Het
Ints8 C A 4: 11,241,684 C253F probably damaging Het
Itga9 A G 9: 118,698,306 probably benign Het
Kcna7 T C 7: 45,406,921 V187A possibly damaging Het
Kdm5b G T 1: 134,613,181 probably benign Het
Knl1 T G 2: 119,076,334 S1635A probably damaging Het
Lce1b A G 3: 92,656,011 S72P unknown Het
Lox T G 18: 52,520,911 probably null Het
Mdc1 A G 17: 35,847,826 D366G possibly damaging Het
Meiob T C 17: 24,834,047 C344R probably damaging Het
Mier2 A G 10: 79,548,830 V150A probably damaging Het
Mon2 A T 10: 123,031,097 M551K probably damaging Het
Mrps15 A G 4: 126,051,394 T125A probably benign Het
Mtmr14 A G 6: 113,253,732 H99R probably damaging Het
Mup4 A G 4: 59,960,598 M1T probably null Het
Mup5 G A 4: 61,832,370 R179* probably null Het
Ncoa3 T G 2: 166,069,301 V1326G possibly damaging Het
Noa1 A T 5: 77,307,581 N429K probably benign Het
Nrxn1 C T 17: 90,162,404 A241T probably damaging Het
Olfr331 C T 11: 58,501,939 V206M probably damaging Het
Olfr59 A T 11: 74,289,300 Y218F probably damaging Het
Pcdh9 G A 14: 93,888,035 S233L probably damaging Het
Peg3 C A 7: 6,709,901 S774I possibly damaging Het
Phyh A G 2: 4,937,809 K321R probably null Het
Plcg1 T A 2: 160,731,920 M35K probably damaging Het
Pnisr C T 4: 21,874,086 probably benign Het
Ppargc1b T A 18: 61,307,204 probably null Het
Prcd A C 11: 116,657,545 S27R probably benign Het
Prx T A 7: 27,517,523 M622K probably benign Het
Psmd1 T A 1: 86,071,845 D51E probably damaging Het
Psmd13 C T 7: 140,883,517 T38I probably damaging Het
Ptprf A C 4: 118,224,899 D1047E possibly damaging Het
Rai14 C A 15: 10,633,228 Q25H probably damaging Het
Riiad1 G A 3: 94,472,869 P40S possibly damaging Het
Rnft1 T A 11: 86,486,270 N53K probably benign Het
Scn4a C T 11: 106,320,820 R1457H probably benign Het
Sema6c A T 3: 95,170,788 I492F probably damaging Het
Shbg T C 11: 69,614,972 H403R probably damaging Het
Slc15a5 A T 6: 138,072,847 probably benign Het
Slc38a1 G A 15: 96,587,135 T221M probably damaging Het
Slc6a16 T A 7: 45,261,176 V375E possibly damaging Het
Slc6a17 T A 3: 107,472,176 M559L probably damaging Het
Slmap A G 14: 26,460,218 probably benign Het
Sorcs2 G A 5: 36,026,748 R965W probably damaging Het
St8sia4 C A 1: 95,653,669 R116L probably damaging Het
Tcaf1 A C 6: 42,675,338 S737A possibly damaging Het
Thbs2 T A 17: 14,678,810 Y676F probably benign Het
Trim75 T C 8: 64,982,739 probably null Het
Ubr5 A T 15: 38,041,846 S169T probably benign Het
Usp54 A T 14: 20,583,440 Y37* probably null Het
Vill T C 9: 119,066,014 F100S probably damaging Het
Vstm5 A G 9: 15,257,367 R76G probably benign Het
Zfp608 T C 18: 54,899,249 T540A probably benign Het
Zfp947 A C 17: 22,146,203 N163K probably benign Het
Zfyve26 T C 12: 79,261,799 H228R possibly damaging Het
Other mutations in Tmod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01477:Tmod2 APN 9 75595001 missense probably benign 0.00
IGL02732:Tmod2 APN 9 75586172 missense possibly damaging 0.94
IGL03255:Tmod2 APN 9 75577258 splice site probably benign
R0589:Tmod2 UTSW 9 75576759 missense probably damaging 1.00
R0723:Tmod2 UTSW 9 75595055 missense possibly damaging 0.93
R2056:Tmod2 UTSW 9 75577242 missense probably benign 0.00
R2119:Tmod2 UTSW 9 75586095 missense possibly damaging 0.46
R2248:Tmod2 UTSW 9 75592649 missense probably benign 0.03
R4522:Tmod2 UTSW 9 75592584 missense probably benign 0.10
R4755:Tmod2 UTSW 9 75597212 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTTGAGAGCCTGTGCCAACTACC -3'
(R):5'- GCACCACTGCTCAGTGCGAATAAAC -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- CTCAGTGCGAATAAACTCACTGTG -3'
Posted On2014-05-14