Incidental Mutation 'R1721:Ubr5'
ID191497
Institutional Source Beutler Lab
Gene Symbol Ubr5
Ensembl Gene ENSMUSG00000037487
Gene Nameubiquitin protein ligase E3 component n-recognin 5
SynonymsEdd, 4432411E13Rik, Edd1
MMRRC Submission 039753-MU
Accession Numbers

NCBI RefSeq: NM_001081359.2, NM_001112721.1; MGI:1918040

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1721 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location37967328-38078854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38041846 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 169 (S169T)
Ref Sequence ENSEMBL: ENSMUSP00000105965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110336] [ENSMUST00000226414]
Predicted Effect probably benign
Transcript: ENSMUST00000110336
AA Change: S169T

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105965
Gene: ENSMUSG00000037487
AA Change: S169T

DomainStartEndE-ValueType
low complexity region 94 111 N/A INTRINSIC
low complexity region 129 156 N/A INTRINSIC
Pfam:E3_UbLigase_EDD 179 230 9.7e-35 PFAM
low complexity region 282 323 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
low complexity region 860 870 N/A INTRINSIC
low complexity region 933 950 N/A INTRINSIC
low complexity region 970 999 N/A INTRINSIC
low complexity region 1140 1151 N/A INTRINSIC
ZnF_UBR1 1177 1244 5.42e-27 SMART
low complexity region 1396 1405 N/A INTRINSIC
low complexity region 1524 1537 N/A INTRINSIC
low complexity region 1567 1613 N/A INTRINSIC
low complexity region 1641 1657 N/A INTRINSIC
low complexity region 1662 1687 N/A INTRINSIC
low complexity region 1726 1742 N/A INTRINSIC
low complexity region 1759 1789 N/A INTRINSIC
low complexity region 1879 1890 N/A INTRINSIC
low complexity region 1972 1983 N/A INTRINSIC
low complexity region 1986 1997 N/A INTRINSIC
Blast:HECTc 2271 2313 2e-6 BLAST
low complexity region 2329 2366 N/A INTRINSIC
PolyA 2389 2452 3.97e-33 SMART
HECTc 2432 2798 1e-151 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226414
AA Change: S169T

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 99% (87/88)
MGI Phenotype Strain: 3052764
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a progestin-induced protein, which belongs to the HECT (homology to E6-AP carboxyl terminus) family. The HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. This gene is localized to chromosome 8q22 which is disrupted in a variety of cancers. This gene potentially has a role in regulation of cell proliferation or differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, impaired growth of the allantois, failure or impairment of chorioallantoic fusion, impaired angiogenesis in the yolk sac and allantois, decreased cell proliferation, and increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(151) : Targeted(3) Gene trapped(148)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,743,598 S743T probably damaging Het
Acin1 A T 14: 54,664,538 V559E probably benign Het
Adamts20 A G 15: 94,338,459 F844L probably benign Het
Adcy5 C A 16: 35,298,424 D1048E probably damaging Het
Agrn A T 4: 156,175,173 C768* probably null Het
Aldh18a1 G T 19: 40,564,838 Q487K probably damaging Het
Aldh3b1 G A 19: 3,921,271 probably benign Het
Asb18 T G 1: 89,968,580 D246A probably benign Het
Atp2b1 T C 10: 98,996,888 V417A probably damaging Het
Bcl2l15 A G 3: 103,838,598 probably null Het
Cage1 T A 13: 38,023,333 K285* probably null Het
Cldn17 A G 16: 88,506,556 L95P probably damaging Het
Cldn20 A T 17: 3,532,882 D110V probably damaging Het
Cnot10 T C 9: 114,614,999 T443A probably benign Het
Col14a1 T A 15: 55,447,462 probably benign Het
Col23a1 T C 11: 51,527,889 Y135H unknown Het
Cse1l T C 2: 166,926,411 S210P probably damaging Het
Cspg4 T G 9: 56,888,743 V1254G probably damaging Het
Ctgf A C 10: 24,596,797 T202P probably damaging Het
Dip2c A G 13: 9,659,368 T1415A probably damaging Het
Epc2 A G 2: 49,532,105 Y337C probably damaging Het
Epha2 A G 4: 141,322,652 S799G probably damaging Het
Fndc10 A G 4: 155,694,898 Y133C probably damaging Het
Gli3 G T 13: 15,726,297 S1423I probably benign Het
Gm6034 A T 17: 36,043,153 probably benign Het
Gmip A G 8: 69,811,232 S109G probably damaging Het
Grik2 C A 10: 49,523,746 W296L possibly damaging Het
Gucy2d T A 7: 98,454,061 L504H probably damaging Het
Il6 T A 5: 30,013,492 Y46N possibly damaging Het
Ints8 C A 4: 11,241,684 C253F probably damaging Het
Itga9 A G 9: 118,698,306 probably benign Het
Kcna7 T C 7: 45,406,921 V187A possibly damaging Het
Kdm5b G T 1: 134,613,181 probably benign Het
Knl1 T G 2: 119,076,334 S1635A probably damaging Het
Lce1b A G 3: 92,656,011 S72P unknown Het
Lox T G 18: 52,520,911 probably null Het
Mdc1 A G 17: 35,847,826 D366G possibly damaging Het
Meiob T C 17: 24,834,047 C344R probably damaging Het
Mier2 A G 10: 79,548,830 V150A probably damaging Het
Mon2 A T 10: 123,031,097 M551K probably damaging Het
Mrps15 A G 4: 126,051,394 T125A probably benign Het
Mtmr14 A G 6: 113,253,732 H99R probably damaging Het
Mup4 A G 4: 59,960,598 M1T probably null Het
Mup5 G A 4: 61,832,370 R179* probably null Het
Ncoa3 T G 2: 166,069,301 V1326G possibly damaging Het
Noa1 A T 5: 77,307,581 N429K probably benign Het
Nrxn1 C T 17: 90,162,404 A241T probably damaging Het
Olfr331 C T 11: 58,501,939 V206M probably damaging Het
Olfr59 A T 11: 74,289,300 Y218F probably damaging Het
Pcdh9 G A 14: 93,888,035 S233L probably damaging Het
Peg3 C A 7: 6,709,901 S774I possibly damaging Het
Phyh A G 2: 4,937,809 K321R probably null Het
Plcg1 T A 2: 160,731,920 M35K probably damaging Het
Pnisr C T 4: 21,874,086 probably benign Het
Ppargc1b T A 18: 61,307,204 probably null Het
Prcd A C 11: 116,657,545 S27R probably benign Het
Prx T A 7: 27,517,523 M622K probably benign Het
Psmd1 T A 1: 86,071,845 D51E probably damaging Het
Psmd13 C T 7: 140,883,517 T38I probably damaging Het
Ptprf A C 4: 118,224,899 D1047E possibly damaging Het
Rai14 C A 15: 10,633,228 Q25H probably damaging Het
Riiad1 G A 3: 94,472,869 P40S possibly damaging Het
Rnft1 T A 11: 86,486,270 N53K probably benign Het
Scn4a C T 11: 106,320,820 R1457H probably benign Het
Sema6c A T 3: 95,170,788 I492F probably damaging Het
Shbg T C 11: 69,614,972 H403R probably damaging Het
Slc15a5 A T 6: 138,072,847 probably benign Het
Slc38a1 G A 15: 96,587,135 T221M probably damaging Het
Slc6a16 T A 7: 45,261,176 V375E possibly damaging Het
Slc6a17 T A 3: 107,472,176 M559L probably damaging Het
Slmap A G 14: 26,460,218 probably benign Het
Sorcs2 G A 5: 36,026,748 R965W probably damaging Het
St8sia4 C A 1: 95,653,669 R116L probably damaging Het
Tcaf1 A C 6: 42,675,338 S737A possibly damaging Het
Thbs2 T A 17: 14,678,810 Y676F probably benign Het
Tmod2 A G 9: 75,586,042 probably benign Het
Trim75 T C 8: 64,982,739 probably null Het
Usp54 A T 14: 20,583,440 Y37* probably null Het
Vill T C 9: 119,066,014 F100S probably damaging Het
Vstm5 A G 9: 15,257,367 R76G probably benign Het
Zfp608 T C 18: 54,899,249 T540A probably benign Het
Zfp947 A C 17: 22,146,203 N163K probably benign Het
Zfyve26 T C 12: 79,261,799 H228R possibly damaging Het
Other mutations in Ubr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ubr5 APN 15 37984036 missense probably damaging 1.00
IGL00548:Ubr5 APN 15 38004321 missense probably benign 0.11
IGL00675:Ubr5 APN 15 38018284 missense possibly damaging 0.84
IGL00770:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00774:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00919:Ubr5 APN 15 38040842 missense probably damaging 1.00
IGL00962:Ubr5 APN 15 37985934 missense probably damaging 1.00
IGL01328:Ubr5 APN 15 37981523 missense possibly damaging 0.82
IGL01359:Ubr5 APN 15 37973006 missense probably damaging 0.96
IGL01394:Ubr5 APN 15 38009631 missense possibly damaging 0.90
IGL01674:Ubr5 APN 15 37998379 missense probably damaging 1.00
IGL01981:Ubr5 APN 15 37996598 missense probably benign 0.08
IGL01993:Ubr5 APN 15 37973012 missense probably damaging 0.99
IGL02159:Ubr5 APN 15 37991379 splice site probably benign
IGL02252:Ubr5 APN 15 38024894 missense probably damaging 1.00
IGL02442:Ubr5 APN 15 38037901 missense possibly damaging 0.95
IGL02502:Ubr5 APN 15 38030689 missense probably benign 0.01
IGL02503:Ubr5 APN 15 38018320 missense possibly damaging 0.90
IGL02503:Ubr5 APN 15 38018314 missense probably damaging 0.99
IGL02546:Ubr5 APN 15 38008747 missense probably benign 0.00
IGL02556:Ubr5 APN 15 38002448 missense probably benign 0.18
IGL02647:Ubr5 APN 15 37992082 missense probably damaging 0.99
IGL02679:Ubr5 APN 15 38002314 missense probably benign 0.36
IGL02726:Ubr5 APN 15 38000562 splice site probably benign
IGL02884:Ubr5 APN 15 37998376 missense probably damaging 1.00
IGL02972:Ubr5 APN 15 38041952 missense probably damaging 1.00
IGL03000:Ubr5 APN 15 38024852 missense probably damaging 0.99
IGL03028:Ubr5 APN 15 38047593 missense probably benign 0.00
IGL03057:Ubr5 APN 15 38040906 splice site probably benign
IGL03085:Ubr5 APN 15 38029568 missense probably damaging 1.00
IGL03198:Ubr5 APN 15 38045720 missense probably damaging 1.00
IGL03368:Ubr5 APN 15 37998316 missense probably damaging 0.96
P0016:Ubr5 UTSW 15 38000578 missense probably damaging 1.00
PIT4142001:Ubr5 UTSW 15 38041909 missense probably damaging 0.98
R0133:Ubr5 UTSW 15 37996571 missense probably damaging 0.98
R0173:Ubr5 UTSW 15 38004675 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0314:Ubr5 UTSW 15 37997187 missense probably damaging 0.99
R0379:Ubr5 UTSW 15 38018957 missense probably benign 0.00
R0390:Ubr5 UTSW 15 38030672 missense probably benign 0.19
R0415:Ubr5 UTSW 15 37972980 missense probably damaging 0.98
R0531:Ubr5 UTSW 15 37991344 missense probably benign 0.34
R0650:Ubr5 UTSW 15 38030807 splice site probably benign
R0720:Ubr5 UTSW 15 37972991 missense probably damaging 0.98
R1183:Ubr5 UTSW 15 37997175 missense possibly damaging 0.71
R1302:Ubr5 UTSW 15 38041479 missense possibly damaging 0.91
R1442:Ubr5 UTSW 15 38014924 splice site probably benign
R1507:Ubr5 UTSW 15 37980870 missense probably damaging 1.00
R1575:Ubr5 UTSW 15 38040841 missense probably damaging 1.00
R1577:Ubr5 UTSW 15 38030730 missense possibly damaging 0.76
R1622:Ubr5 UTSW 15 38009113 unclassified probably benign
R1799:Ubr5 UTSW 15 37989377 missense probably damaging 1.00
R1840:Ubr5 UTSW 15 37980917 missense possibly damaging 0.51
R1867:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1868:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R2065:Ubr5 UTSW 15 38040842 missense probably damaging 1.00
R2107:Ubr5 UTSW 15 37989302 missense probably benign 0.00
R2201:Ubr5 UTSW 15 38002299 missense possibly damaging 0.83
R2261:Ubr5 UTSW 15 37988284 missense probably damaging 0.99
R2441:Ubr5 UTSW 15 37989345 missense probably damaging 0.99
R2512:Ubr5 UTSW 15 38002319 missense probably damaging 1.00
R3008:Ubr5 UTSW 15 38030845 missense probably benign
R3412:Ubr5 UTSW 15 38004235 splice site probably benign
R3898:Ubr5 UTSW 15 37997739 missense probably benign 0.02
R3900:Ubr5 UTSW 15 38019242 missense probably damaging 1.00
R4032:Ubr5 UTSW 15 38024837 missense probably benign 0.22
R4352:Ubr5 UTSW 15 38041573 missense probably benign 0.31
R4362:Ubr5 UTSW 15 38078403 missense probably damaging 0.99
R4467:Ubr5 UTSW 15 38004336 missense probably damaging 1.00
R4507:Ubr5 UTSW 15 38013542 missense probably damaging 0.96
R4683:Ubr5 UTSW 15 38037967 missense probably damaging 1.00
R4771:Ubr5 UTSW 15 38018297 missense possibly damaging 0.50
R4878:Ubr5 UTSW 15 38006564 missense probably benign 0.01
R4999:Ubr5 UTSW 15 38009668 missense probably benign 0.06
R5057:Ubr5 UTSW 15 38004109 missense probably damaging 0.98
R5177:Ubr5 UTSW 15 38006517 missense probably benign 0.22
R5186:Ubr5 UTSW 15 37997916 missense probably damaging 0.99
R5378:Ubr5 UTSW 15 37989578 missense probably damaging 1.00
R5486:Ubr5 UTSW 15 38008739 missense probably benign 0.00
R5494:Ubr5 UTSW 15 38019281 missense possibly damaging 0.78
R5617:Ubr5 UTSW 15 38030657 missense possibly damaging 0.47
R5636:Ubr5 UTSW 15 37983996 missense probably damaging 1.00
R5655:Ubr5 UTSW 15 38015093 missense probably damaging 0.99
R5715:Ubr5 UTSW 15 38002233 missense probably benign 0.06
R5781:Ubr5 UTSW 15 38006541 missense probably benign 0.27
R6645:Ubr5 UTSW 15 38029506 missense probably damaging 1.00
R6774:Ubr5 UTSW 15 38015135 missense probably damaging 1.00
R6823:Ubr5 UTSW 15 37989598 missense probably benign 0.08
R6877:Ubr5 UTSW 15 38002570 missense probably damaging 0.98
X0024:Ubr5 UTSW 15 37992060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCCTTGTAGAACAACTTGTGCCT -3'
(R):5'- GGCTCTGAACTGGACTCATCTCCT -3'

Sequencing Primer
(F):5'- CCTGAAGTCTTCTAAGTTGGTAAAC -3'
(R):5'- ctgagtggtgggattacaagg -3'
Posted On2014-05-14