Incidental Mutation 'R1721:Adamts20'
ID191499
Institutional Source Beutler Lab
Gene Symbol Adamts20
Ensembl Gene ENSMUSG00000022449
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20
SynonymsADAMTS-20, bt
MMRRC Submission 039753-MU
Accession Numbers

Genbank: NM_177431; MGI: 2660628

Stock #R1721 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location94270163-94465418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94338459 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 844 (F844L)
Ref Sequence ENSEMBL: ENSMUSP00000036330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035342] [ENSMUST00000155907]
Predicted Effect probably benign
Transcript: ENSMUST00000035342
AA Change: F844L

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036330
Gene: ENSMUSG00000022449
AA Change: F844L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 186 1.4e-30 PFAM
Pfam:Reprolysin_5 253 445 3.6e-13 PFAM
Pfam:Reprolysin_4 253 460 1.1e-7 PFAM
Pfam:Reprolysin 255 464 1.5e-26 PFAM
Pfam:Reprolysin_2 272 454 1.8e-10 PFAM
Pfam:Reprolysin_3 276 410 5.8e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 2.6e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
TSP1 1416 1470 1.69e-2 SMART
TSP1 1471 1526 2.3e0 SMART
TSP1 1530 1579 1.23e0 SMART
TSP1 1653 1706 5.27e-4 SMART
Pfam:GON 1708 1905 5.8e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155907
AA Change: F844L

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121696
Gene: ENSMUSG00000022449
AA Change: F844L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 40 186 1e-31 PFAM
Pfam:Reprolysin_5 253 445 2.7e-13 PFAM
Pfam:Reprolysin_4 253 460 7.2e-8 PFAM
Pfam:Reprolysin 255 464 2.4e-28 PFAM
Pfam:Reprolysin_2 272 454 4e-10 PFAM
Pfam:Reprolysin_3 276 410 1.1e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 2e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 99% (87/88)
MGI Phenotype Homozygous mutants have a white belt across the back in the midtrunk region and a white belly patch that coalesces to form a white belt.
Allele List at MGI

All alleles(17) : Targeted, other(1) Spontaneous(11) Chemically induced(5)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,743,598 S743T probably damaging Het
AC150897.1 T A 7: 45,261,176 V375E noncoding transcript Het
Acin1 A T 14: 54,664,538 V559E probably benign Het
Adcy5 C A 16: 35,298,424 D1048E probably damaging Het
Agrn A T 4: 156,175,173 C768* probably null Het
Aldh18a1 G T 19: 40,564,838 Q489K probably damaging Het
Aldh3b1 G A 19: 3,921,271 Het
Asb18 T G 1: 89,968,580 D246A probably benign Het
Atp2b1 T C 10: 98,996,888 V417A possibly damaging Het
B930041F14Rik A G 4: 155,694,898 Y133C probably damaging Het
Bcl2l15 A G 3: 103,838,598 probably null Het
Cage1 T A 13: 38,023,333 K285* probably null Het
Casc5 T G 2: 119,076,334 S1635A probably damaging Het
Cdhr4 C T 9: 107,998,803 noncoding transcript Het
Cldn17 A G 16: 88,506,556 L95P probably damaging Het
Cldn20 A T 17: 3,532,882 D110V probably damaging Het
Cnot10 T C 9: 114,614,999 T443A probably benign Het
Col14a1 T A 15: 55,447,462 D1195E unknown Het
Col23a1 T C 11: 51,527,889 Y135H unknown Het
Cse1l T C 2: 166,926,411 S210P probably damaging Het
Cspg4 T G 9: 56,888,743 V1254G probably damaging Het
Ctgf A C 10: 24,596,797 T202P probably damaging Het
Dip2c A G 13: 9,659,368 T1416A probably damaging Het
Epc2 A G 2: 49,532,105 Y337C probably damaging Het
Epha2 A G 4: 141,322,652 S799G probably damaging Het
Gli3 G T 13: 15,726,297 S1423I probably benign Het
Gm11744 A C 11: 116,657,545 S27R probably benign Het
Gm6034 A T 17: 36,043,153 E8D unknown Het
Gmip A G 8: 69,811,232 S109G probably damaging Het
Grik2 C A 10: 49,523,746 W296L possibly damaging Het
Gucy2d T A 7: 98,454,061 L503H probably benign Het
Il6 T A 5: 30,013,492 Y46N possibly damaging Het
Ints8 C A 4: 11,241,684 C253F probably damaging Het
Itga9 A G 9: 118,698,306 noncoding transcript Het
Kcna7 T C 7: 45,406,921 V187A possibly damaging Het
Kdm5b G T 1: 134,613,181 Het
Lce1b A G 3: 92,656,011 S72P unknown Het
Lcn10 A G 2: 25,684,016 noncoding transcript Het
Lox T G 18: 52,520,911 probably null Het
Mdc1 A G 17: 35,847,826 D366G possibly damaging Het
Mdn1 T C 4: 32,730,997 noncoding transcript Het
Meiob T C 17: 24,834,047 C344R probably damaging Het
Mier2 A G 10: 79,548,830 V148A probably damaging Het
Mon2 A T 10: 123,031,097 M551K probably damaging Het
Mrps15 A G 4: 126,051,394 T125A probably benign Het
Mtmr14 A G 6: 113,253,732 H99R probably damaging Het
Mup4 A G 4: 59,960,598 M1T probably null Het
Mup5 G A 4: 61,832,370 R179* probably null Het
Ncoa3 T G 2: 166,069,301 V1327G possibly damaging Het
Noa1 A T 5: 77,307,581 N429K probably benign Het
Nrxn1 C T 17: 90,162,404 A241T probably damaging Het
Olfr331 C T 11: 58,501,939 V206M probably damaging Het
Olfr59 A T 11: 74,289,300 Y218F probably damaging Het
Pcdh9 G A 14: 93,888,035 S233L probably damaging Het
Peg3 C A 7: 6,709,901 S774I possibly damaging Het
Phyh A G 2: 4,937,809 K321R probably null Het
Plcg1 T A 2: 160,731,920 M35K probably damaging Het
Pnisr C T 4: 21,874,086 R610W unknown Het
Ppargc1b T A 18: 61,307,204 probably null Het
Prx T A 7: 27,517,523 M622K probably benign Het
Psmd1 T A 1: 86,071,845 D51E probably damaging Het
Psmd13 C T 7: 140,883,517 T38I probably damaging Het
Ptprf A C 4: 118,224,899 D1047E possibly damaging Het
Rai14 C A 15: 10,633,228 Q25H probably damaging Het
Riiad1 G A 3: 94,472,869 P40S possibly damaging Het
Rnft1 T A 11: 86,486,270 N53K probably benign Het
Scn4a C T 11: 106,320,820 R1457H probably benign Het
Sema6c A T 3: 95,170,788 I492F probably damaging Het
Shbg T C 11: 69,614,972 H403R probably damaging Het
Slc15a5 A T 6: 138,072,847 Het
Slc38a1 G A 15: 96,587,135 T221M probably damaging Het
Slc6a17 T A 3: 107,472,176 M559L probably damaging Het
Slmap A G 14: 26,460,218 noncoding transcript Het
Sorcs2 G A 5: 36,026,748 R965W probably damaging Het
St8sia4 C A 1: 95,653,669 R116L probably damaging Het
Tcaf1 A C 6: 42,675,338 S737A possibly damaging Het
Thbs2 T A 17: 14,678,810 Y676F probably benign Het
Tmod2 A G 9: 75,586,042 Het
Trim75 T C 8: 64,982,739 Q353R probably benign Het
Ubr5 A T 15: 38,041,846 S169T probably benign Het
Usp54 A T 14: 20,583,440 Y342* probably null Het
Vill T C 9: 119,066,014 F100S probably damaging Het
Vstm5 A G 9: 15,257,367 R76G probably benign Het
Zfp608 T C 18: 54,899,249 T540A probably benign Het
Zfp947 A C 17: 22,146,203 N163K probably benign Het
Zfyve26 T C 12: 79,261,799 H1657R possibly damaging Het
Other mutations in Adamts20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Adamts20 APN 15 94394641 missense probably benign
IGL00491:Adamts20 APN 15 94273232 missense possibly damaging 0.89
IGL00502:Adamts20 APN 15 94403397 missense probably damaging 0.99
IGL00672:Adamts20 APN 15 94341105 missense probably damaging 0.99
IGL00840:Adamts20 APN 15 94282482 missense probably damaging 1.00
IGL00909:Adamts20 APN 15 94379813 missense probably damaging 1.00
IGL01101:Adamts20 APN 15 94344042 missense probably damaging 1.00
IGL01137:Adamts20 APN 15 94394611 unclassified probably null
IGL01457:Adamts20 APN 15 94331448 missense probably damaging 0.97
IGL01685:Adamts20 APN 15 94403446 missense possibly damaging 0.81
IGL01949:Adamts20 APN 15 94326106 missense probably benign 0.08
IGL02525:Adamts20 APN 15 94283078 unclassified probably null
IGL03088:Adamts20 APN 15 94329914 unclassified probably null
IGL03175:Adamts20 APN 15 94273255 nonsense probably null
belt UTSW 15 94345990 missense probably damaging 1.00
buckeye UTSW 15 94341087 missense probably damaging 1.00
jack_white UTSW 15 unclassified
meowth UTSW 15 94331458 missense probably damaging 1.00
nidoking UTSW 15 94403445 missense
panda UTSW 15 94326699 nonsense
pikachu UTSW 15 94345990 missense probably damaging 1.00
poliwag UTSW 15 94394622 nonsense
splotch2 UTSW 15 94335561 splice acceptor site
Wash UTSW 15 94347670 nonsense
whitebelly UTSW 15 unclassified
R0483:Adamts20 UTSW 15 94353571 missense probably benign 0.00
R0514:Adamts20 UTSW 15 94270376 missense probably damaging 1.00
R0568:Adamts20 UTSW 15 94291713 splice acceptor site probably benign
R0730:Adamts20 UTSW 15 94347690 missense probably benign 0.00
R0973:Adamts20 UTSW 15 94286371 missense probably benign 0.00
R1339:Adamts20 UTSW 15 94322896 missense probably benign 0.19
R1691:Adamts20 UTSW 15 94403565 splice acceptor site noncoding transcript
R1832:Adamts20 UTSW 15 94286344 missense probably benign 0.00
R1846:Adamts20 UTSW 15 94345990 missense probably damaging 1.00
R1867:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1875:Adamts20 UTSW 15 94331396 missense probably benign 0.01
R1930:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1931:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1932:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R2001:Adamts20 UTSW 15 94347718 missense possibly damaging 0.96
R2068:Adamts20 UTSW 15 94282458 splice donor site
R2116:Adamts20 UTSW 15 94355362 missense probably damaging 1.00
R2162:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R2331:Adamts20 UTSW 15 94283087 splice acceptor site
R2350:Adamts20 UTSW 15 94283916 missense probably damaging 1.00
R2484:Adamts20 UTSW 15 94403360 missense silent
R2887:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2889:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2890:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R3109:Adamts20 UTSW 15 94345904 splice site unknown
R3719:Adamts20 UTSW 15 94361838 missense probably damaging 0.99
R3832:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R3901:Adamts20 UTSW 15 94328845 missense possibly damaging 0.81
R4398:Adamts20 UTSW 15 94333695 missense possibly damaging 0.93
R4402:Adamts20 UTSW 15 94379946 missense probably benign
R4431:Adamts20 UTSW 15 94344043 missense probably damaging 1.00
R4479:Adamts20 UTSW 15 94403445 missense probably damaging 1.00
R4482:Adamts20 UTSW 15 94345920 missense probably damaging 1.00
R4503:Adamts20 UTSW 15 94379750 missense probably damaging 0.99
R4671:Adamts20 UTSW 15 94403325 missense possibly damaging 0.48
R4700:Adamts20 UTSW 15 94394622 nonsense probably null
R4707:Adamts20 UTSW 15 94333647 missense possibly damaging 0.53
R4725:Adamts20 UTSW 15 94351762 missense probably damaging 0.99
R4771:Adamts20 UTSW 15 94351635 synonymous probably null
R4829:Adamts20 UTSW 15 94326396 missense probably benign 0.01
R4937:Adamts20 UTSW 15 94379775 missense probably benign
R4960:Adamts20 UTSW 15 94379774 missense probably benign
R5270:Adamts20 UTSW 15 94282519 missense probably benign 0.00
R5388:Adamts20 UTSW 15 94345778 missense possibly damaging 0.81
R5410:Adamts20 UTSW 15 94281957 missense possibly damaging 0.94
R5453:Adamts20 UTSW 15 94326088 missense possibly damaging 0.69
R5611:Adamts20 UTSW 15 94273280 missense possibly damaging 0.65
R5687:Adamts20 UTSW 15 94325971 missense probably benign 0.36
R5758:Adamts20 UTSW 15 94394650 missense probably benign 0.00
R5801:Adamts20 UTSW 15 94347670 nonsense probably null
R5834:Adamts20 UTSW 15 94353584 missense probably damaging 0.99
R5993:Adamts20 UTSW 15 94338723 missense probably damaging 0.99
R5997:Adamts20 UTSW 15 94379747 missense probably damaging 1.00
R6044:Adamts20 UTSW 15 94282483 missense probably damaging 1.00
R6058:Adamts20 UTSW 15 94330047 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGACAGGGTACGTTGCAAGC -3'
(R):5'- AGAATTAACAGCACGGACCGGC -3'

Sequencing Primer
(F):5'- AAGCCCGTGTGCTCTGTG -3'
(R):5'- CTAACGGCTAGTAGGCAGC -3'
Posted OnMay 14, 2014