Incidental Mutation 'R1722:Mmp16'
ID191529
Institutional Source Beutler Lab
Gene Symbol Mmp16
Ensembl Gene ENSMUSG00000028226
Gene Namematrix metallopeptidase 16
SynonymsMT3-MMP, Membrane type 3-MMP
MMRRC Submission 039754-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1722 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location17852893-18119145 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18051767 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 252 (L252Q)
Ref Sequence ENSEMBL: ENSMUSP00000139102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029881] [ENSMUST00000183662]
Predicted Effect probably damaging
Transcript: ENSMUST00000029881
AA Change: L252Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029881
Gene: ENSMUSG00000028226
AA Change: L252Q

DomainStartEndE-ValueType
Pfam:PG_binding_1 38 96 3e-11 PFAM
ZnMc 123 292 1.62e-54 SMART
low complexity region 313 336 N/A INTRINSIC
HX 347 390 1.36e-7 SMART
HX 392 436 3.61e-12 SMART
HX 439 485 1.86e-14 SMART
HX 487 532 4.96e-10 SMART
Pfam:DUF3377 537 607 6.6e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139418
Predicted Effect probably damaging
Transcript: ENSMUST00000183662
AA Change: L252Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139102
Gene: ENSMUSG00000028226
AA Change: L252Q

DomainStartEndE-ValueType
Pfam:PG_binding_1 38 96 9.9e-12 PFAM
ZnMc 123 292 1.62e-54 SMART
low complexity region 313 336 N/A INTRINSIC
HX 347 390 1.36e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein exhibit retarded growth of the skeleton, especially in the cranium and long bones. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a gene disruption display normal morphology, clinical chemistry, hematology, and behavior. Mice homozygous for a null allele exhibit reduced skeletal growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931422A03Rik A T 2: 103,993,928 probably null Het
Adssl1 A T 12: 112,636,481 I346F possibly damaging Het
Ahnak T A 19: 9,010,655 L3101H probably damaging Het
Aldh3b3 A G 19: 3,964,871 I123V possibly damaging Het
Angptl1 C T 1: 156,857,085 P275S possibly damaging Het
Apoa5 C T 9: 46,270,549 Q308* probably null Het
Arhgef12 T C 9: 43,020,717 *106W probably null Het
Atp2c1 A G 9: 105,439,400 Y485H probably benign Het
Atp6v1b1 C T 6: 83,743,092 T3I possibly damaging Het
Btbd7 A T 12: 102,812,654 I451N possibly damaging Het
Clasp1 T G 1: 118,590,464 L1080R probably damaging Het
Clec4f A G 6: 83,646,933 V408A probably benign Het
Clint1 T A 11: 45,906,406 M438K possibly damaging Het
Cuzd1 A T 7: 131,311,644 Y415N probably damaging Het
Ddias A G 7: 92,860,042 F222L possibly damaging Het
Efcab7 A T 4: 99,900,618 T321S probably benign Het
Elp3 A T 14: 65,551,397 D393E probably benign Het
Fbn2 T C 18: 58,048,052 probably null Het
Fcgr3 T C 1: 171,054,119 R146G possibly damaging Het
Fkrp G A 7: 16,810,794 A381V probably benign Het
Gatad2b T G 3: 90,355,679 I476S probably damaging Het
Gm1527 C T 3: 28,921,634 H557Y probably benign Het
Gm2431 A T 7: 142,257,862 C102S unknown Het
Hoxd13 A G 2: 74,670,045 N310S probably benign Het
Il9 T A 13: 56,479,395 T135S probably benign Het
Ints4 A C 7: 97,513,579 N476T probably benign Het
Kcnq4 A C 4: 120,702,427 D525E probably benign Het
Kncn A T 4: 115,885,899 Y57F probably damaging Het
Lpl TGG TG 8: 68,896,602 probably null Het
Lrrfip2 A G 9: 111,199,761 T351A probably damaging Het
Madd T C 2: 91,167,637 E682G probably benign Het
March7 A C 2: 60,234,182 R267S probably damaging Het
Mri1 A T 8: 84,253,925 V296D possibly damaging Het
Myo3a A G 2: 22,399,827 T665A probably benign Het
N4bp2 T C 5: 65,806,882 V758A probably benign Het
Nbea T C 3: 55,665,695 D2489G probably damaging Het
Neb T C 2: 52,256,745 T2836A probably damaging Het
Nedd4l T A 18: 65,157,939 V203E probably damaging Het
Nkpd1 C A 7: 19,523,921 Q392K possibly damaging Het
Nploc4 G T 11: 120,382,569 A576E probably benign Het
Nxph1 T A 6: 9,247,516 N162K probably damaging Het
Olfr1356 T A 10: 78,846,971 T315S probably benign Het
Olfr410 T C 11: 74,334,445 Y262C probably damaging Het
Pabpc2 T G 18: 39,775,116 I478S probably benign Het
Pde7b G T 10: 20,436,244 H190Q probably damaging Het
Plekha2 A T 8: 25,042,960 S332T probably benign Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rasl11a A T 5: 146,845,242 H9L probably benign Het
Rer1 A T 4: 155,075,001 F177I probably damaging Het
Rinl T C 7: 28,792,244 L74P probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Rttn T C 18: 88,973,531 V78A probably benign Het
Skint5 A T 4: 113,846,311 probably null Het
Tenm2 A C 11: 36,008,103 Y2743D probably damaging Het
Tmem101 T C 11: 102,154,693 Y110C probably damaging Het
Trim9 T C 12: 70,248,374 N658S probably benign Het
Ucp1 A T 8: 83,290,688 T36S probably benign Het
Vmn2r43 A G 7: 8,255,068 I382T probably damaging Het
Zfp142 C T 1: 74,569,776 R1620Q probably damaging Het
Zfp386 T C 12: 116,059,906 S380P probably damaging Het
Other mutations in Mmp16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Mmp16 APN 4 18011784 missense probably benign 0.03
IGL01074:Mmp16 APN 4 18110584 splice site probably benign
IGL01125:Mmp16 APN 4 18112066 missense possibly damaging 0.95
IGL01309:Mmp16 APN 4 18116185 missense probably damaging 0.98
IGL01543:Mmp16 APN 4 18051743 missense probably damaging 1.00
IGL02036:Mmp16 APN 4 18093371 missense probably benign 0.00
IGL02252:Mmp16 APN 4 18110523 missense probably damaging 1.00
IGL03037:Mmp16 APN 4 17996222 missense probably damaging 0.98
R0483:Mmp16 UTSW 4 18115878 splice site probably benign
R0565:Mmp16 UTSW 4 17987705 missense probably damaging 1.00
R0885:Mmp16 UTSW 4 18054491 missense probably benign 0.12
R0966:Mmp16 UTSW 4 18115930 missense probably benign 0.31
R1158:Mmp16 UTSW 4 17987726 splice site probably null
R1290:Mmp16 UTSW 4 18051725 missense probably damaging 1.00
R1326:Mmp16 UTSW 4 18054517 missense possibly damaging 0.61
R1345:Mmp16 UTSW 4 18112021 missense probably benign 0.01
R1424:Mmp16 UTSW 4 18112121 splice site probably null
R1610:Mmp16 UTSW 4 18011582 missense probably benign 0.00
R1867:Mmp16 UTSW 4 18116013 missense probably benign 0.00
R2354:Mmp16 UTSW 4 18112001 missense probably damaging 1.00
R2431:Mmp16 UTSW 4 18054491 missense probably benign 0.12
R2992:Mmp16 UTSW 4 18011657 missense probably damaging 1.00
R5245:Mmp16 UTSW 4 18054596 intron probably benign
R5534:Mmp16 UTSW 4 18110452 missense probably damaging 0.99
R5941:Mmp16 UTSW 4 18054354 splice site probably benign
R5961:Mmp16 UTSW 4 17853842 missense probably benign 0.37
R6160:Mmp16 UTSW 4 18051857 missense probably damaging 1.00
R6514:Mmp16 UTSW 4 18116123 missense probably damaging 1.00
R6570:Mmp16 UTSW 4 18011501 missense possibly damaging 0.64
R6866:Mmp16 UTSW 4 17853800 missense probably benign 0.23
R7037:Mmp16 UTSW 4 18116148 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGTGAGAATTTGCAGTGTGAGACCAC -3'
(R):5'- TGCCACATAGGGTTTAGCAAACAGG -3'

Sequencing Primer
(F):5'- AACCTCTATTGATCACTGGAGTGAG -3'
(R):5'- GGAGTAGTGGAACCTACCATATATC -3'
Posted On2014-05-14