Incidental Mutation 'R1722:Kcnq4'
ID191533
Institutional Source Beutler Lab
Gene Symbol Kcnq4
Ensembl Gene ENSMUSG00000028631
Gene Namepotassium voltage-gated channel, subfamily Q, member 4
Synonyms
MMRRC Submission 039754-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.376) question?
Stock #R1722 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location120696138-120748612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 120702427 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 525 (D525E)
Ref Sequence ENSEMBL: ENSMUSP00000030376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030376]
Predicted Effect probably benign
Transcript: ENSMUST00000030376
AA Change: D525E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030376
Gene: ENSMUSG00000028631
AA Change: D525E

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 36 77 N/A INTRINSIC
Pfam:Ion_trans 99 331 1.2e-28 PFAM
Pfam:Ion_trans_2 244 324 5.4e-16 PFAM
Pfam:KCNQ_channel 465 655 1.6e-93 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a potassium channel that is thought to play a critical role in the regulation of neuronal excitability, particularly in sensory cells of the cochlea. The current generated by this channel is inhibited by M1 muscarinic acetylcholine receptors and activated by retigabine, a novel anti-convulsant drug. The encoded protein can form a homomultimeric potassium channel or possibly a heteromultimeric channel in association with the protein encoded by the KCNQ3 gene. Defects in this gene are a cause of nonsyndromic sensorineural deafness type 2 (DFNA2), an autosomal dominant form of progressive hearing loss. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either homozygous for a knock-out allele or homozygous for a dominant negative knock-in allele exhibit a slowly progressive hearing loss due to chronic depolarization and subsequent degeneration of cochlear outer hair cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931422A03Rik A T 2: 103,993,928 probably null Het
Adssl1 A T 12: 112,636,481 I346F possibly damaging Het
Ahnak T A 19: 9,010,655 L3101H probably damaging Het
Aldh3b3 A G 19: 3,964,871 I123V possibly damaging Het
Angptl1 C T 1: 156,857,085 P275S possibly damaging Het
Apoa5 C T 9: 46,270,549 Q308* probably null Het
Arhgef12 T C 9: 43,020,717 *106W probably null Het
Atp2c1 A G 9: 105,439,400 Y485H probably benign Het
Atp6v1b1 C T 6: 83,743,092 T3I possibly damaging Het
Btbd7 A T 12: 102,812,654 I451N possibly damaging Het
Clasp1 T G 1: 118,590,464 L1080R probably damaging Het
Clec4f A G 6: 83,646,933 V408A probably benign Het
Clint1 T A 11: 45,906,406 M438K possibly damaging Het
Cuzd1 A T 7: 131,311,644 Y415N probably damaging Het
Ddias A G 7: 92,860,042 F222L possibly damaging Het
Efcab7 A T 4: 99,900,618 T321S probably benign Het
Elp3 A T 14: 65,551,397 D393E probably benign Het
Fbn2 T C 18: 58,048,052 probably null Het
Fcgr3 T C 1: 171,054,119 R146G possibly damaging Het
Fkrp G A 7: 16,810,794 A381V probably benign Het
Gatad2b T G 3: 90,355,679 I476S probably damaging Het
Gm1527 C T 3: 28,921,634 H557Y probably benign Het
Gm2431 A T 7: 142,257,862 C102S unknown Het
Hoxd13 A G 2: 74,670,045 N310S probably benign Het
Il9 T A 13: 56,479,395 T135S probably benign Het
Ints4 A C 7: 97,513,579 N476T probably benign Het
Kncn A T 4: 115,885,899 Y57F probably damaging Het
Lpl TGG TG 8: 68,896,602 probably null Het
Lrrfip2 A G 9: 111,199,761 T351A probably damaging Het
Madd T C 2: 91,167,637 E682G probably benign Het
March7 A C 2: 60,234,182 R267S probably damaging Het
Mmp16 T A 4: 18,051,767 L252Q probably damaging Het
Mri1 A T 8: 84,253,925 V296D possibly damaging Het
Myo3a A G 2: 22,399,827 T665A probably benign Het
N4bp2 T C 5: 65,806,882 V758A probably benign Het
Nbea T C 3: 55,665,695 D2489G probably damaging Het
Neb T C 2: 52,256,745 T2836A probably damaging Het
Nedd4l T A 18: 65,157,939 V203E probably damaging Het
Nkpd1 C A 7: 19,523,921 Q392K possibly damaging Het
Nploc4 G T 11: 120,382,569 A576E probably benign Het
Nxph1 T A 6: 9,247,516 N162K probably damaging Het
Olfr1356 T A 10: 78,846,971 T315S probably benign Het
Olfr410 T C 11: 74,334,445 Y262C probably damaging Het
Pabpc2 T G 18: 39,775,116 I478S probably benign Het
Pde7b G T 10: 20,436,244 H190Q probably damaging Het
Plekha2 A T 8: 25,042,960 S332T probably benign Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rasl11a A T 5: 146,845,242 H9L probably benign Het
Rer1 A T 4: 155,075,001 F177I probably damaging Het
Rinl T C 7: 28,792,244 L74P probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Rttn T C 18: 88,973,531 V78A probably benign Het
Skint5 A T 4: 113,846,311 probably null Het
Tenm2 A C 11: 36,008,103 Y2743D probably damaging Het
Tmem101 T C 11: 102,154,693 Y110C probably damaging Het
Trim9 T C 12: 70,248,374 N658S probably benign Het
Ucp1 A T 8: 83,290,688 T36S probably benign Het
Vmn2r43 A G 7: 8,255,068 I382T probably damaging Het
Zfp142 C T 1: 74,569,776 R1620Q probably damaging Het
Zfp386 T C 12: 116,059,906 S380P probably damaging Het
Other mutations in Kcnq4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Kcnq4 APN 4 120698016 nonsense probably null
IGL00225:Kcnq4 APN 4 120698016 nonsense probably null
IGL00228:Kcnq4 APN 4 120698016 nonsense probably null
IGL00310:Kcnq4 APN 4 120698016 nonsense probably null
IGL00330:Kcnq4 APN 4 120698016 nonsense probably null
IGL00333:Kcnq4 APN 4 120698016 nonsense probably null
IGL00335:Kcnq4 APN 4 120698016 nonsense probably null
IGL00336:Kcnq4 APN 4 120698016 nonsense probably null
IGL01143:Kcnq4 APN 4 120698623 missense probably damaging 1.00
IGL01373:Kcnq4 APN 4 120717032 missense probably damaging 1.00
IGL02095:Kcnq4 APN 4 120700027 splice site probably benign
IGL02335:Kcnq4 APN 4 120715854 missense probably damaging 1.00
IGL03188:Kcnq4 APN 4 120704426 missense possibly damaging 0.81
R0045:Kcnq4 UTSW 4 120697955 missense probably damaging 0.99
R0045:Kcnq4 UTSW 4 120697955 missense probably damaging 0.99
R0423:Kcnq4 UTSW 4 120717508 missense probably damaging 1.00
R0483:Kcnq4 UTSW 4 120716601 missense probably damaging 1.00
R0837:Kcnq4 UTSW 4 120746861 missense probably benign 0.00
R1826:Kcnq4 UTSW 4 120704504 missense probably benign 0.00
R2059:Kcnq4 UTSW 4 120698002 missense probably benign 0.00
R4327:Kcnq4 UTSW 4 120711364 missense probably benign 0.00
R4690:Kcnq4 UTSW 4 120717011 missense probably damaging 0.99
R4706:Kcnq4 UTSW 4 120704486 missense probably benign
R4729:Kcnq4 UTSW 4 120713074 missense possibly damaging 0.47
R4806:Kcnq4 UTSW 4 120713094 missense probably damaging 1.00
R4859:Kcnq4 UTSW 4 120716613 missense probably damaging 1.00
R4885:Kcnq4 UTSW 4 120713063 missense probably benign 0.01
R5073:Kcnq4 UTSW 4 120717517 missense probably damaging 1.00
R5517:Kcnq4 UTSW 4 120715809 missense possibly damaging 0.66
R5590:Kcnq4 UTSW 4 120715885 missense probably damaging 0.98
R5653:Kcnq4 UTSW 4 120702411 missense probably benign 0.00
R5750:Kcnq4 UTSW 4 120715049 missense probably damaging 1.00
R6141:Kcnq4 UTSW 4 120715869 missense probably damaging 1.00
R6160:Kcnq4 UTSW 4 120716559 missense probably damaging 1.00
R7087:Kcnq4 UTSW 4 120704399 missense probably damaging 0.96
R7088:Kcnq4 UTSW 4 120704399 missense probably damaging 0.96
R7143:Kcnq4 UTSW 4 120711239 missense probably benign 0.05
R7225:Kcnq4 UTSW 4 120746914 missense probably benign 0.03
R7479:Kcnq4 UTSW 4 120715825 missense probably damaging 0.98
X0020:Kcnq4 UTSW 4 120715327 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTGAATGGAGCAGACACTGTG -3'
(R):5'- TTCCCATGAGTCCCACTAATGGAGG -3'

Sequencing Primer
(F):5'- AGTGCTGGAAGCCATATGCTC -3'
(R):5'- CACTAATGGAGGTGGGGGC -3'
Posted On2014-05-14