Incidental Mutation 'R1722:Nkpd1'
ID191544
Institutional Source Beutler Lab
Gene Symbol Nkpd1
Ensembl Gene ENSMUSG00000060621
Gene NameNTPase, KAP family P-loop domain containing 1
Synonyms
MMRRC Submission 039754-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R1722 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location19517838-19525056 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 19523921 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 392 (Q392K)
Ref Sequence ENSEMBL: ENSMUSP00000151162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078908] [ENSMUST00000207576] [ENSMUST00000214205]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078908
AA Change: Q542K

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000077943
Gene: ENSMUSG00000060621
AA Change: Q542K

DomainStartEndE-ValueType
low complexity region 71 103 N/A INTRINSIC
low complexity region 129 158 N/A INTRINSIC
Pfam:KAP_NTPase 186 642 5.7e-29 PFAM
low complexity region 771 780 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000207576
AA Change: Q542K

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214205
AA Change: Q392K

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931422A03Rik A T 2: 103,993,928 probably null Het
Adssl1 A T 12: 112,636,481 I346F possibly damaging Het
Ahnak T A 19: 9,010,655 L3101H probably damaging Het
Aldh3b3 A G 19: 3,964,871 I123V possibly damaging Het
Angptl1 C T 1: 156,857,085 P275S possibly damaging Het
Apoa5 C T 9: 46,270,549 Q308* probably null Het
Arhgef12 T C 9: 43,020,717 *106W probably null Het
Atp2c1 A G 9: 105,439,400 Y485H probably benign Het
Atp6v1b1 C T 6: 83,743,092 T3I possibly damaging Het
Btbd7 A T 12: 102,812,654 I451N possibly damaging Het
Clasp1 T G 1: 118,590,464 L1080R probably damaging Het
Clec4f A G 6: 83,646,933 V408A probably benign Het
Clint1 T A 11: 45,906,406 M438K possibly damaging Het
Cuzd1 A T 7: 131,311,644 Y415N probably damaging Het
Ddias A G 7: 92,860,042 F222L possibly damaging Het
Efcab7 A T 4: 99,900,618 T321S probably benign Het
Elp3 A T 14: 65,551,397 D393E probably benign Het
Fbn2 T C 18: 58,048,052 probably null Het
Fcgr3 T C 1: 171,054,119 R146G possibly damaging Het
Fkrp G A 7: 16,810,794 A381V probably benign Het
Gatad2b T G 3: 90,355,679 I476S probably damaging Het
Gm1527 C T 3: 28,921,634 H557Y probably benign Het
Gm2431 A T 7: 142,257,862 C102S unknown Het
Hoxd13 A G 2: 74,670,045 N310S probably benign Het
Il9 T A 13: 56,479,395 T135S probably benign Het
Ints4 A C 7: 97,513,579 N476T probably benign Het
Kcnq4 A C 4: 120,702,427 D525E probably benign Het
Kncn A T 4: 115,885,899 Y57F probably damaging Het
Lpl TGG TG 8: 68,896,602 probably null Het
Lrrfip2 A G 9: 111,199,761 T351A probably damaging Het
Madd T C 2: 91,167,637 E682G probably benign Het
March7 A C 2: 60,234,182 R267S probably damaging Het
Mmp16 T A 4: 18,051,767 L252Q probably damaging Het
Mri1 A T 8: 84,253,925 V296D possibly damaging Het
Myo3a A G 2: 22,399,827 T665A probably benign Het
N4bp2 T C 5: 65,806,882 V758A probably benign Het
Nbea T C 3: 55,665,695 D2489G probably damaging Het
Neb T C 2: 52,256,745 T2836A probably damaging Het
Nedd4l T A 18: 65,157,939 V203E probably damaging Het
Nploc4 G T 11: 120,382,569 A576E probably benign Het
Nxph1 T A 6: 9,247,516 N162K probably damaging Het
Olfr1356 T A 10: 78,846,971 T315S probably benign Het
Olfr410 T C 11: 74,334,445 Y262C probably damaging Het
Pabpc2 T G 18: 39,775,116 I478S probably benign Het
Pde7b G T 10: 20,436,244 H190Q probably damaging Het
Plekha2 A T 8: 25,042,960 S332T probably benign Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rasl11a A T 5: 146,845,242 H9L probably benign Het
Rer1 A T 4: 155,075,001 F177I probably damaging Het
Rinl T C 7: 28,792,244 L74P probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Rttn T C 18: 88,973,531 V78A probably benign Het
Skint5 A T 4: 113,846,311 probably null Het
Tenm2 A C 11: 36,008,103 Y2743D probably damaging Het
Tmem101 T C 11: 102,154,693 Y110C probably damaging Het
Trim9 T C 12: 70,248,374 N658S probably benign Het
Ucp1 A T 8: 83,290,688 T36S probably benign Het
Vmn2r43 A G 7: 8,255,068 I382T probably damaging Het
Zfp142 C T 1: 74,569,776 R1620Q probably damaging Het
Zfp386 T C 12: 116,059,906 S380P probably damaging Het
Other mutations in Nkpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Nkpd1 APN 7 19518749 missense possibly damaging 0.71
IGL01140:Nkpd1 APN 7 19523462 missense possibly damaging 0.72
IGL01450:Nkpd1 APN 7 19523625 missense probably damaging 1.00
R0003:Nkpd1 UTSW 7 19519927 missense probably benign
R0626:Nkpd1 UTSW 7 19523174 missense probably benign 0.02
R1171:Nkpd1 UTSW 7 19524087 missense possibly damaging 0.94
R1637:Nkpd1 UTSW 7 19523979 missense probably benign 0.00
R1823:Nkpd1 UTSW 7 19523252 missense probably damaging 1.00
R2141:Nkpd1 UTSW 7 19524237 missense probably damaging 0.99
R2224:Nkpd1 UTSW 7 19519820 missense probably benign 0.00
R2225:Nkpd1 UTSW 7 19519820 missense probably benign 0.00
R2226:Nkpd1 UTSW 7 19519820 missense probably benign 0.00
R2274:Nkpd1 UTSW 7 19523897 missense probably benign 0.01
R2275:Nkpd1 UTSW 7 19523897 missense probably benign 0.01
R2374:Nkpd1 UTSW 7 19523975 missense possibly damaging 0.50
R3108:Nkpd1 UTSW 7 19522978 missense probably damaging 0.98
R4940:Nkpd1 UTSW 7 19523573 nonsense probably null
R5182:Nkpd1 UTSW 7 19523256 missense probably damaging 1.00
R5362:Nkpd1 UTSW 7 19523268 missense probably damaging 1.00
R5458:Nkpd1 UTSW 7 19524276 missense probably damaging 1.00
R5681:Nkpd1 UTSW 7 19523573 nonsense probably null
R5684:Nkpd1 UTSW 7 19523573 nonsense probably null
R5685:Nkpd1 UTSW 7 19523573 nonsense probably null
R6177:Nkpd1 UTSW 7 19523084 missense probably damaging 1.00
R6200:Nkpd1 UTSW 7 19524603 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- CTTCATCTTCATCCTGGTGGTGGAC -3'
(R):5'- GGGCACGTACTCATACAGGCAATC -3'

Sequencing Primer
(F):5'- TGGTGGACCCCAGCATTC -3'
(R):5'- ATCACCCTCGTCATGCAGG -3'
Posted On2014-05-14