Incidental Mutation 'R1722:Cuzd1'
ID191550
Institutional Source Beutler Lab
Gene Symbol Cuzd1
Ensembl Gene ENSMUSG00000040205
Gene NameCUB and zona pellucida-like domains 1
SynonymsERG-1, UTCZP, UO-44, Itmap1
MMRRC Submission 039754-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R1722 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location131308554-131322292 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 131311644 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 415 (Y415N)
Ref Sequence ENSEMBL: ENSMUSP00000037168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046611] [ENSMUST00000124096]
Predicted Effect probably damaging
Transcript: ENSMUST00000046611
AA Change: Y415N

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000037168
Gene: ENSMUSG00000040205
AA Change: Y415N

DomainStartEndE-ValueType
CUB 32 146 1.78e-16 SMART
CUB 154 265 1.1e-44 SMART
ZP 276 519 1.39e-63 SMART
transmembrane domain 571 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Female mice homozygous for disruption of this gene exhibit impaired mammary gland development during puberty and during and following pregnancy and do not lactate. Homozygous mutant mice show an increased susceptibility to induced pancreatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931422A03Rik A T 2: 103,993,928 probably null Het
Adssl1 A T 12: 112,636,481 I346F possibly damaging Het
Ahnak T A 19: 9,010,655 L3101H probably damaging Het
Aldh3b3 A G 19: 3,964,871 I123V possibly damaging Het
Angptl1 C T 1: 156,857,085 P275S possibly damaging Het
Apoa5 C T 9: 46,270,549 Q308* probably null Het
Arhgef12 T C 9: 43,020,717 *106W probably null Het
Atp2c1 A G 9: 105,439,400 Y485H probably benign Het
Atp6v1b1 C T 6: 83,743,092 T3I possibly damaging Het
Btbd7 A T 12: 102,812,654 I451N possibly damaging Het
Clasp1 T G 1: 118,590,464 L1080R probably damaging Het
Clec4f A G 6: 83,646,933 V408A probably benign Het
Clint1 T A 11: 45,906,406 M438K possibly damaging Het
Ddias A G 7: 92,860,042 F222L possibly damaging Het
Efcab7 A T 4: 99,900,618 T321S probably benign Het
Elp3 A T 14: 65,551,397 D393E probably benign Het
Fbn2 T C 18: 58,048,052 probably null Het
Fcgr3 T C 1: 171,054,119 R146G possibly damaging Het
Fkrp G A 7: 16,810,794 A381V probably benign Het
Gatad2b T G 3: 90,355,679 I476S probably damaging Het
Gm1527 C T 3: 28,921,634 H557Y probably benign Het
Gm2431 A T 7: 142,257,862 C102S unknown Het
Hoxd13 A G 2: 74,670,045 N310S probably benign Het
Il9 T A 13: 56,479,395 T135S probably benign Het
Ints4 A C 7: 97,513,579 N476T probably benign Het
Kcnq4 A C 4: 120,702,427 D525E probably benign Het
Kncn A T 4: 115,885,899 Y57F probably damaging Het
Lpl TGG TG 8: 68,896,602 probably null Het
Lrrfip2 A G 9: 111,199,761 T351A probably damaging Het
Madd T C 2: 91,167,637 E682G probably benign Het
March7 A C 2: 60,234,182 R267S probably damaging Het
Mmp16 T A 4: 18,051,767 L252Q probably damaging Het
Mri1 A T 8: 84,253,925 V296D possibly damaging Het
Myo3a A G 2: 22,399,827 T665A probably benign Het
N4bp2 T C 5: 65,806,882 V758A probably benign Het
Nbea T C 3: 55,665,695 D2489G probably damaging Het
Neb T C 2: 52,256,745 T2836A probably damaging Het
Nedd4l T A 18: 65,157,939 V203E probably damaging Het
Nkpd1 C A 7: 19,523,921 Q392K possibly damaging Het
Nploc4 G T 11: 120,382,569 A576E probably benign Het
Nxph1 T A 6: 9,247,516 N162K probably damaging Het
Olfr1356 T A 10: 78,846,971 T315S probably benign Het
Olfr410 T C 11: 74,334,445 Y262C probably damaging Het
Pabpc2 T G 18: 39,775,116 I478S probably benign Het
Pde7b G T 10: 20,436,244 H190Q probably damaging Het
Plekha2 A T 8: 25,042,960 S332T probably benign Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rasl11a A T 5: 146,845,242 H9L probably benign Het
Rer1 A T 4: 155,075,001 F177I probably damaging Het
Rinl T C 7: 28,792,244 L74P probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Rttn T C 18: 88,973,531 V78A probably benign Het
Skint5 A T 4: 113,846,311 probably null Het
Tenm2 A C 11: 36,008,103 Y2743D probably damaging Het
Tmem101 T C 11: 102,154,693 Y110C probably damaging Het
Trim9 T C 12: 70,248,374 N658S probably benign Het
Ucp1 A T 8: 83,290,688 T36S probably benign Het
Vmn2r43 A G 7: 8,255,068 I382T probably damaging Het
Zfp142 C T 1: 74,569,776 R1620Q probably damaging Het
Zfp386 T C 12: 116,059,906 S380P probably damaging Het
Other mutations in Cuzd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Cuzd1 APN 7 131316136 missense probably damaging 0.99
IGL01140:Cuzd1 APN 7 131311794 missense probably damaging 1.00
IGL01773:Cuzd1 APN 7 131314885 missense probably damaging 1.00
IGL02960:Cuzd1 APN 7 131320103 missense probably benign 0.01
R0233:Cuzd1 UTSW 7 131311816 missense possibly damaging 0.61
R0233:Cuzd1 UTSW 7 131311816 missense possibly damaging 0.61
R0363:Cuzd1 UTSW 7 131316262 missense probably benign 0.16
R0375:Cuzd1 UTSW 7 131311908 intron probably benign
R0446:Cuzd1 UTSW 7 131316280 splice site probably null
R0482:Cuzd1 UTSW 7 131309872 unclassified probably benign
R0765:Cuzd1 UTSW 7 131316095 missense probably benign 0.40
R0932:Cuzd1 UTSW 7 131320194 intron probably benign
R1463:Cuzd1 UTSW 7 131316642 missense probably damaging 1.00
R1533:Cuzd1 UTSW 7 131311703 missense probably damaging 0.99
R1920:Cuzd1 UTSW 7 131309696 missense probably benign 0.00
R2027:Cuzd1 UTSW 7 131320091 missense possibly damaging 0.93
R2039:Cuzd1 UTSW 7 131309616 missense probably benign 0.00
R2039:Cuzd1 UTSW 7 131314914 intron probably benign
R2857:Cuzd1 UTSW 7 131316134 missense probably damaging 0.97
R2859:Cuzd1 UTSW 7 131316134 missense probably damaging 0.97
R4585:Cuzd1 UTSW 7 131314800 missense probably damaging 1.00
R4586:Cuzd1 UTSW 7 131314800 missense probably damaging 1.00
R4830:Cuzd1 UTSW 7 131318054 missense probably damaging 0.99
R4945:Cuzd1 UTSW 7 131316621 missense probably damaging 1.00
R5009:Cuzd1 UTSW 7 131311523 missense probably damaging 1.00
R5337:Cuzd1 UTSW 7 131316074 missense probably damaging 1.00
R5355:Cuzd1 UTSW 7 131316124 missense probably damaging 1.00
R6543:Cuzd1 UTSW 7 131309768 missense probably damaging 1.00
R6569:Cuzd1 UTSW 7 131311757 missense probably damaging 1.00
R6681:Cuzd1 UTSW 7 131311683 missense probably damaging 1.00
R6818:Cuzd1 UTSW 7 131316665 missense probably damaging 1.00
R6819:Cuzd1 UTSW 7 131309731 missense possibly damaging 0.51
R7031:Cuzd1 UTSW 7 131308851 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TGCTGGGAAATACACGAGCACATAC -3'
(R):5'- AGAGGACCACGCGATCAGCTATAC -3'

Sequencing Primer
(F):5'- ACATACCCGCTGCTGATTAAGTC -3'
(R):5'- CAGGATCACCTTCATCGAGTC -3'
Posted On2014-05-14