Incidental Mutation 'R1722:Mri1'
ID191555
Institutional Source Beutler Lab
Gene Symbol Mri1
Ensembl Gene ENSMUSG00000004996
Gene Namemethylthioribose-1-phosphate isomerase 1
Synonyms2410018C20Rik
MMRRC Submission 039754-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.389) question?
Stock #R1722 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location84249906-84257326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84253925 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 296 (V296D)
Ref Sequence ENSEMBL: ENSMUSP00000122623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005120] [ENSMUST00000019506] [ENSMUST00000098578] [ENSMUST00000126435]
Predicted Effect probably benign
Transcript: ENSMUST00000005120
SMART Domains Protein: ENSMUSP00000005120
Gene: ENSMUSG00000004994

DomainStartEndE-ValueType
Pfam:DUF572 1 198 1.7e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000005122
SMART Domains Protein: ENSMUSP00000005122
Gene: ENSMUSG00000004996

DomainStartEndE-ValueType
Pfam:IF-2B 40 152 9.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000019506
SMART Domains Protein: ENSMUSP00000019506
Gene: ENSMUSG00000019362

DomainStartEndE-ValueType
Pfam:DUF2462 1 87 5.5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098578
SMART Domains Protein: ENSMUSP00000096177
Gene: ENSMUSG00000004994

DomainStartEndE-ValueType
Pfam:DUF572 1 384 1.4e-101 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000125498
AA Change: V167D
SMART Domains Protein: ENSMUSP00000117115
Gene: ENSMUSG00000004996
AA Change: V167D

DomainStartEndE-ValueType
Pfam:IF-2B 2 226 5.9e-55 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000126435
AA Change: V296D

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122623
Gene: ENSMUSG00000004996
AA Change: V296D

DomainStartEndE-ValueType
Pfam:IF-2B 44 346 4.8e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127747
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164476
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This enzyme functions in the methionine salvage pathway by catalyzing the interconversion of methylthioribose-1-phosphate and methythioribulose-1-phosphate. Elevated expression of the encoded protein is associated with metastatic melanoma and this protein promotes melanoma cell invasion independent of its enzymatic activity. Mutations in this gene may be associated with vanishing white matter disease (VMWD). [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931422A03Rik A T 2: 103,993,928 probably null Het
Adssl1 A T 12: 112,636,481 I346F possibly damaging Het
Ahnak T A 19: 9,010,655 L3101H probably damaging Het
Aldh3b3 A G 19: 3,964,871 I123V possibly damaging Het
Angptl1 C T 1: 156,857,085 P275S possibly damaging Het
Apoa5 C T 9: 46,270,549 Q308* probably null Het
Arhgef12 T C 9: 43,020,717 *106W probably null Het
Atp2c1 A G 9: 105,439,400 Y485H probably benign Het
Atp6v1b1 C T 6: 83,743,092 T3I possibly damaging Het
Btbd7 A T 12: 102,812,654 I451N possibly damaging Het
Clasp1 T G 1: 118,590,464 L1080R probably damaging Het
Clec4f A G 6: 83,646,933 V408A probably benign Het
Clint1 T A 11: 45,906,406 M438K possibly damaging Het
Cuzd1 A T 7: 131,311,644 Y415N probably damaging Het
Ddias A G 7: 92,860,042 F222L possibly damaging Het
Efcab7 A T 4: 99,900,618 T321S probably benign Het
Elp3 A T 14: 65,551,397 D393E probably benign Het
Fbn2 T C 18: 58,048,052 probably null Het
Fcgr3 T C 1: 171,054,119 R146G possibly damaging Het
Fkrp G A 7: 16,810,794 A381V probably benign Het
Gatad2b T G 3: 90,355,679 I476S probably damaging Het
Gm1527 C T 3: 28,921,634 H557Y probably benign Het
Gm2431 A T 7: 142,257,862 C102S unknown Het
Hoxd13 A G 2: 74,670,045 N310S probably benign Het
Il9 T A 13: 56,479,395 T135S probably benign Het
Ints4 A C 7: 97,513,579 N476T probably benign Het
Kcnq4 A C 4: 120,702,427 D525E probably benign Het
Kncn A T 4: 115,885,899 Y57F probably damaging Het
Lpl TGG TG 8: 68,896,602 probably null Het
Lrrfip2 A G 9: 111,199,761 T351A probably damaging Het
Madd T C 2: 91,167,637 E682G probably benign Het
March7 A C 2: 60,234,182 R267S probably damaging Het
Mmp16 T A 4: 18,051,767 L252Q probably damaging Het
Myo3a A G 2: 22,399,827 T665A probably benign Het
N4bp2 T C 5: 65,806,882 V758A probably benign Het
Nbea T C 3: 55,665,695 D2489G probably damaging Het
Neb T C 2: 52,256,745 T2836A probably damaging Het
Nedd4l T A 18: 65,157,939 V203E probably damaging Het
Nkpd1 C A 7: 19,523,921 Q392K possibly damaging Het
Nploc4 G T 11: 120,382,569 A576E probably benign Het
Nxph1 T A 6: 9,247,516 N162K probably damaging Het
Olfr1356 T A 10: 78,846,971 T315S probably benign Het
Olfr410 T C 11: 74,334,445 Y262C probably damaging Het
Pabpc2 T G 18: 39,775,116 I478S probably benign Het
Pde7b G T 10: 20,436,244 H190Q probably damaging Het
Plekha2 A T 8: 25,042,960 S332T probably benign Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rasl11a A T 5: 146,845,242 H9L probably benign Het
Rer1 A T 4: 155,075,001 F177I probably damaging Het
Rinl T C 7: 28,792,244 L74P probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Rttn T C 18: 88,973,531 V78A probably benign Het
Skint5 A T 4: 113,846,311 probably null Het
Tenm2 A C 11: 36,008,103 Y2743D probably damaging Het
Tmem101 T C 11: 102,154,693 Y110C probably damaging Het
Trim9 T C 12: 70,248,374 N658S probably benign Het
Ucp1 A T 8: 83,290,688 T36S probably benign Het
Vmn2r43 A G 7: 8,255,068 I382T probably damaging Het
Zfp142 C T 1: 74,569,776 R1620Q probably damaging Het
Zfp386 T C 12: 116,059,906 S380P probably damaging Het
Other mutations in Mri1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mri1 APN 8 84251648 missense probably damaging 1.00
IGL02226:Mri1 APN 8 84256295 missense probably damaging 1.00
IGL02642:Mri1 APN 8 84257073 missense probably damaging 1.00
IGL03365:Mri1 APN 8 84251633 missense possibly damaging 0.52
R4372:Mri1 UTSW 8 84253925 missense probably benign 0.07
R4456:Mri1 UTSW 8 84256406 missense probably benign 0.19
R5943:Mri1 UTSW 8 84254319 nonsense probably null
R7084:Mri1 UTSW 8 84251079 missense not run
R7142:Mri1 UTSW 8 84257124 missense not run
Predicted Primers PCR Primer
(F):5'- TGAGCCCCAAACTCAGGTCCTTTC -3'
(R):5'- GGCATCCAGAACCAGGTATGTGAC -3'

Sequencing Primer
(F):5'- AACTCAGGTCCTTTCCCAAC -3'
(R):5'- CAGGTATGTGACCTCCCTAAC -3'
Posted On2014-05-14