Incidental Mutation 'R1722:Rapgef6'
ID191567
Institutional Source Beutler Lab
Gene Symbol Rapgef6
Ensembl Gene ENSMUSG00000037533
Gene NameRap guanine nucleotide exchange factor (GEF) 6
SynonymsPDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2
MMRRC Submission 039754-MU
Accession Numbers

Genbank: NM_175258; MGI: 2384761

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1722 (G1)
Quality Score217
Status Not validated
Chromosome11
Chromosomal Location54522847-54699285 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TG to TGG at 54546397 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108895] [ENSMUST00000207429]
Predicted Effect probably null
Transcript: ENSMUST00000101206
SMART Domains Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.45e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1095 5.35e-87 SMART
low complexity region 1237 1250 N/A INTRINSIC
low complexity region 1270 1293 N/A INTRINSIC
low complexity region 1345 1364 N/A INTRINSIC
low complexity region 1368 1380 N/A INTRINSIC
low complexity region 1444 1452 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1591 1604 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102743
SMART Domains Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.42e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1138 3.88e-84 SMART
low complexity region 1229 1242 N/A INTRINSIC
low complexity region 1262 1285 N/A INTRINSIC
low complexity region 1337 1356 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
low complexity region 1436 1444 N/A INTRINSIC
low complexity region 1547 1560 N/A INTRINSIC
low complexity region 1583 1596 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108895
SMART Domains Protein: ENSMUSP00000104523
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.95e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 526 1.03e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155132
Predicted Effect probably null
Transcript: ENSMUST00000207429
Meta Mutation Damage Score 0.6088 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931422A03Rik A T 2: 103,993,928 probably null Het
Adssl1 A T 12: 112,636,481 I346F possibly damaging Het
Ahnak T A 19: 9,010,655 L3101H probably damaging Het
Aldh3b3 A G 19: 3,964,871 I123V possibly damaging Het
Angptl1 C T 1: 156,857,085 P275S possibly damaging Het
Apoa5 C T 9: 46,270,549 Q308* probably null Het
Arhgef12 T C 9: 43,020,717 *106W probably null Het
Atp2c1 A G 9: 105,439,400 Y485H probably benign Het
Atp6v1b1 C T 6: 83,743,092 T3I possibly damaging Het
Btbd7 A T 12: 102,812,654 I451N possibly damaging Het
Clasp1 T G 1: 118,590,464 L1080R probably damaging Het
Clec4f A G 6: 83,646,933 V408A probably benign Het
Clint1 T A 11: 45,906,406 M438K possibly damaging Het
Cuzd1 A T 7: 131,311,644 Y415N probably damaging Het
Ddias A G 7: 92,860,042 F222L possibly damaging Het
Efcab7 A T 4: 99,900,618 T321S probably benign Het
Elp3 A T 14: 65,551,397 D393E probably benign Het
Fbn2 T C 18: 58,048,052 probably null Het
Fcgr3 T C 1: 171,054,119 R146G possibly damaging Het
Fkrp G A 7: 16,810,794 A381V probably benign Het
Gatad2b T G 3: 90,355,679 I476S probably damaging Het
Gm1527 C T 3: 28,921,634 H557Y probably benign Het
Gm2431 A T 7: 142,257,862 C102S unknown Het
Hoxd13 A G 2: 74,670,045 N310S probably benign Het
Il9 T A 13: 56,479,395 T135S probably benign Het
Ints4 A C 7: 97,513,579 N476T probably benign Het
Kcnq4 A C 4: 120,702,427 D525E probably benign Het
Kncn A T 4: 115,885,899 Y57F probably damaging Het
Lpl TGG TG 8: 68,896,602 probably null Het
Lrrfip2 A G 9: 111,199,761 T351A probably damaging Het
Madd T C 2: 91,167,637 E682G probably benign Het
March7 A C 2: 60,234,182 R267S probably damaging Het
Mmp16 T A 4: 18,051,767 L252Q probably damaging Het
Mri1 A T 8: 84,253,925 V296D possibly damaging Het
Myo3a A G 2: 22,399,827 T665A probably benign Het
N4bp2 T C 5: 65,806,882 V758A probably benign Het
Nbea T C 3: 55,665,695 D2489G probably damaging Het
Neb T C 2: 52,256,745 T2836A probably damaging Het
Nedd4l T A 18: 65,157,939 V203E probably damaging Het
Nkpd1 C A 7: 19,523,921 Q392K possibly damaging Het
Nploc4 G T 11: 120,382,569 A576E probably benign Het
Nxph1 T A 6: 9,247,516 N162K probably damaging Het
Olfr1356 T A 10: 78,846,971 T315S probably benign Het
Olfr410 T C 11: 74,334,445 Y262C probably damaging Het
Pabpc2 T G 18: 39,775,116 I478S probably benign Het
Pde7b G T 10: 20,436,244 H190Q probably damaging Het
Plekha2 A T 8: 25,042,960 S332T probably benign Het
Rasl11a A T 5: 146,845,242 H9L probably benign Het
Rer1 A T 4: 155,075,001 F177I probably damaging Het
Rinl T C 7: 28,792,244 L74P probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Rttn T C 18: 88,973,531 V78A probably benign Het
Skint5 A T 4: 113,846,311 probably null Het
Tenm2 A C 11: 36,008,103 Y2743D probably damaging Het
Tmem101 T C 11: 102,154,693 Y110C probably damaging Het
Trim9 T C 12: 70,248,374 N658S probably benign Het
Ucp1 A T 8: 83,290,688 T36S probably benign Het
Vmn2r43 A G 7: 8,255,068 I382T probably damaging Het
Zfp142 C T 1: 74,569,776 R1620Q probably damaging Het
Zfp386 T C 12: 116,059,906 S380P probably damaging Het
Other mutations in Rapgef6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Rapgef6 APN 11 54679265 missense probably benign 0.00
IGL00507:Rapgef6 APN 11 54664109 nonsense probably null
IGL00809:Rapgef6 APN 11 54649300 missense probably damaging 1.00
IGL00843:Rapgef6 APN 11 54691273 missense probably benign 0.03
IGL00899:Rapgef6 APN 11 54620018 nonsense probably null
IGL01372:Rapgef6 APN 11 54668611 splice site probably benign
IGL01604:Rapgef6 APN 11 54694563 missense probably damaging 0.99
IGL01935:Rapgef6 APN 11 54610842 missense possibly damaging 0.78
IGL01991:Rapgef6 APN 11 54552869 missense probably benign 0.37
IGL02243:Rapgef6 APN 11 54676400 missense probably damaging 1.00
IGL02407:Rapgef6 APN 11 54676355 missense possibly damaging 0.91
IGL02676:Rapgef6 APN 11 54649346 unclassified probably benign
IGL02934:Rapgef6 APN 11 54625864 missense probably damaging 1.00
IGL03076:Rapgef6 APN 11 54625967 missense probably damaging 1.00
IGL03110:Rapgef6 APN 11 54696089 missense probably damaging 0.97
IGL03256:Rapgef6 APN 11 54657429 missense probably damaging 1.00
shocker UTSW 11 54620016 missense probably damaging 1.00
D4216:Rapgef6 UTSW 11 54668746 splice site probably benign
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0125:Rapgef6 UTSW 11 54625875 nonsense probably null
R0189:Rapgef6 UTSW 11 54691249 missense probably benign
R0201:Rapgef6 UTSW 11 54619941 missense probably damaging 1.00
R0505:Rapgef6 UTSW 11 54625963 missense probably benign 0.00
R0524:Rapgef6 UTSW 11 54690284 missense probably benign 0.32
R0853:Rapgef6 UTSW 11 54668677 missense probably damaging 1.00
R1203:Rapgef6 UTSW 11 54691699 missense probably benign 0.09
R1440:Rapgef6 UTSW 11 54626708 missense probably damaging 1.00
R1453:Rapgef6 UTSW 11 54639727 intron probably null
R1530:Rapgef6 UTSW 11 54661183 missense probably damaging 1.00
R1593:Rapgef6 UTSW 11 54546397 frame shift probably null
R1620:Rapgef6 UTSW 11 54626594 missense possibly damaging 0.88
R1628:Rapgef6 UTSW 11 54546397 frame shift probably null
R1629:Rapgef6 UTSW 11 54546397 frame shift probably null
R1630:Rapgef6 UTSW 11 54546397 frame shift probably null
R1634:Rapgef6 UTSW 11 54546397 frame shift probably null
R1640:Rapgef6 UTSW 11 54657405 missense probably damaging 1.00
R1686:Rapgef6 UTSW 11 54691632 missense possibly damaging 0.81
R1743:Rapgef6 UTSW 11 54676284 missense probably damaging 1.00
R1816:Rapgef6 UTSW 11 54694488 missense probably benign
R1851:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1852:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1868:Rapgef6 UTSW 11 54546397 frame shift probably null
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1942:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R1943:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R2031:Rapgef6 UTSW 11 54552858 missense probably benign 0.30
R2087:Rapgef6 UTSW 11 54631249 missense probably damaging 1.00
R2106:Rapgef6 UTSW 11 54668686 missense probably benign 0.17
R2362:Rapgef6 UTSW 11 54694272 missense probably damaging 1.00
R2484:Rapgef6 UTSW 11 54642756 missense possibly damaging 0.48
R2566:Rapgef6 UTSW 11 54687711 missense possibly damaging 0.66
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R3744:Rapgef6 UTSW 11 54625934 missense probably benign 0.40
R3848:Rapgef6 UTSW 11 54691308 missense probably damaging 0.97
R4823:Rapgef6 UTSW 11 54694500 missense probably benign 0.08
R4859:Rapgef6 UTSW 11 54636163 missense probably benign
R4906:Rapgef6 UTSW 11 54552836 missense probably damaging 1.00
R4911:Rapgef6 UTSW 11 54622317 missense probably damaging 0.97
R4937:Rapgef6 UTSW 11 54657317 missense probably damaging 1.00
R5033:Rapgef6 UTSW 11 54691381 missense possibly damaging 0.92
R5249:Rapgef6 UTSW 11 54523117 missense probably benign 0.19
R5304:Rapgef6 UTSW 11 54657374 missense probably benign 0.01
R5656:Rapgef6 UTSW 11 54636136 missense possibly damaging 0.95
R5701:Rapgef6 UTSW 11 54676394 missense possibly damaging 0.76
R5758:Rapgef6 UTSW 11 54668644 missense probably damaging 1.00
R5973:Rapgef6 UTSW 11 54639783 missense probably damaging 1.00
R6177:Rapgef6 UTSW 11 54620016 missense probably damaging 1.00
R6268:Rapgef6 UTSW 11 54649247 missense probably damaging 1.00
R6287:Rapgef6 UTSW 11 54626338 intron probably null
R6293:Rapgef6 UTSW 11 54634781 missense probably damaging 1.00
R6471:Rapgef6 UTSW 11 54691737 missense probably damaging 0.99
R6863:Rapgef6 UTSW 11 54546380 missense probably benign 0.00
R6950:Rapgef6 UTSW 11 54676380 missense probably benign 0.09
R7144:Rapgef6 UTSW 11 54657365 missense not run
Predicted Primers PCR Primer
(F):5'- CAGCCTCAATCCACCTGCATATGG -3'
(R):5'- AAGCCAGTGTCTTTAGCAACAGTAGTC -3'

Sequencing Primer
(F):5'- CAGGCATAGGCCACTATGACTG -3'
(R):5'- GCACGAAACTGTTTCCTATGT -3'
Posted On2014-05-14