Incidental Mutation 'R1722:Tmem101'
ID191569
Institutional Source Beutler Lab
Gene Symbol Tmem101
Ensembl Gene ENSMUSG00000020921
Gene Nametransmembrane protein 101
Synonyms
MMRRC Submission 039754-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R1722 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location102152546-102156404 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102154693 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 110 (Y110C)
Ref Sequence ENSEMBL: ENSMUSP00000021296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021296]
Predicted Effect probably damaging
Transcript: ENSMUST00000021296
AA Change: Y110C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021296
Gene: ENSMUSG00000020921
AA Change: Y110C

DomainStartEndE-ValueType
Pfam:TMEM101 8 256 9.9e-122 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143986
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931422A03Rik A T 2: 103,993,928 probably null Het
Adssl1 A T 12: 112,636,481 I346F possibly damaging Het
Ahnak T A 19: 9,010,655 L3101H probably damaging Het
Aldh3b3 A G 19: 3,964,871 I123V possibly damaging Het
Angptl1 C T 1: 156,857,085 P275S possibly damaging Het
Apoa5 C T 9: 46,270,549 Q308* probably null Het
Arhgef12 T C 9: 43,020,717 *106W probably null Het
Atp2c1 A G 9: 105,439,400 Y485H probably benign Het
Atp6v1b1 C T 6: 83,743,092 T3I possibly damaging Het
Btbd7 A T 12: 102,812,654 I451N possibly damaging Het
Clasp1 T G 1: 118,590,464 L1080R probably damaging Het
Clec4f A G 6: 83,646,933 V408A probably benign Het
Clint1 T A 11: 45,906,406 M438K possibly damaging Het
Cuzd1 A T 7: 131,311,644 Y415N probably damaging Het
Ddias A G 7: 92,860,042 F222L possibly damaging Het
Efcab7 A T 4: 99,900,618 T321S probably benign Het
Elp3 A T 14: 65,551,397 D393E probably benign Het
Fbn2 T C 18: 58,048,052 probably null Het
Fcgr3 T C 1: 171,054,119 R146G possibly damaging Het
Fkrp G A 7: 16,810,794 A381V probably benign Het
Gatad2b T G 3: 90,355,679 I476S probably damaging Het
Gm1527 C T 3: 28,921,634 H557Y probably benign Het
Gm2431 A T 7: 142,257,862 C102S unknown Het
Hoxd13 A G 2: 74,670,045 N310S probably benign Het
Il9 T A 13: 56,479,395 T135S probably benign Het
Ints4 A C 7: 97,513,579 N476T probably benign Het
Kcnq4 A C 4: 120,702,427 D525E probably benign Het
Kncn A T 4: 115,885,899 Y57F probably damaging Het
Lpl TGG TG 8: 68,896,602 probably null Het
Lrrfip2 A G 9: 111,199,761 T351A probably damaging Het
Madd T C 2: 91,167,637 E682G probably benign Het
March7 A C 2: 60,234,182 R267S probably damaging Het
Mmp16 T A 4: 18,051,767 L252Q probably damaging Het
Mri1 A T 8: 84,253,925 V296D possibly damaging Het
Myo3a A G 2: 22,399,827 T665A probably benign Het
N4bp2 T C 5: 65,806,882 V758A probably benign Het
Nbea T C 3: 55,665,695 D2489G probably damaging Het
Neb T C 2: 52,256,745 T2836A probably damaging Het
Nedd4l T A 18: 65,157,939 V203E probably damaging Het
Nkpd1 C A 7: 19,523,921 Q392K possibly damaging Het
Nploc4 G T 11: 120,382,569 A576E probably benign Het
Nxph1 T A 6: 9,247,516 N162K probably damaging Het
Olfr1356 T A 10: 78,846,971 T315S probably benign Het
Olfr410 T C 11: 74,334,445 Y262C probably damaging Het
Pabpc2 T G 18: 39,775,116 I478S probably benign Het
Pde7b G T 10: 20,436,244 H190Q probably damaging Het
Plekha2 A T 8: 25,042,960 S332T probably benign Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rasl11a A T 5: 146,845,242 H9L probably benign Het
Rer1 A T 4: 155,075,001 F177I probably damaging Het
Rinl T C 7: 28,792,244 L74P probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Rttn T C 18: 88,973,531 V78A probably benign Het
Skint5 A T 4: 113,846,311 probably null Het
Tenm2 A C 11: 36,008,103 Y2743D probably damaging Het
Trim9 T C 12: 70,248,374 N658S probably benign Het
Ucp1 A T 8: 83,290,688 T36S probably benign Het
Vmn2r43 A G 7: 8,255,068 I382T probably damaging Het
Zfp142 C T 1: 74,569,776 R1620Q probably damaging Het
Zfp386 T C 12: 116,059,906 S380P probably damaging Het
Other mutations in Tmem101
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Tmem101 APN 11 102154660 missense probably damaging 0.99
IGL01096:Tmem101 APN 11 102154552 splice site probably null
IGL01593:Tmem101 APN 11 102155878 missense probably damaging 1.00
IGL01814:Tmem101 APN 11 102153458 missense possibly damaging 0.58
IGL02451:Tmem101 APN 11 102153293 missense probably damaging 1.00
IGL03238:Tmem101 APN 11 102155785 missense probably damaging 1.00
R0462:Tmem101 UTSW 11 102155867 missense probably benign 0.08
R0848:Tmem101 UTSW 11 102155866 missense possibly damaging 0.65
R1465:Tmem101 UTSW 11 102153329 missense probably damaging 0.97
R1465:Tmem101 UTSW 11 102153329 missense probably damaging 0.97
R1928:Tmem101 UTSW 11 102153396 missense probably benign
R2082:Tmem101 UTSW 11 102153377 missense probably benign 0.17
R4577:Tmem101 UTSW 11 102155837 missense possibly damaging 0.48
R4724:Tmem101 UTSW 11 102153443 missense probably benign 0.32
R4729:Tmem101 UTSW 11 102156329 missense probably benign 0.25
R5146:Tmem101 UTSW 11 102154624 missense probably benign
R5184:Tmem101 UTSW 11 102156233 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- ACTTGAAGCACCCTTCAGAAGGAAC -3'
(R):5'- ACTACATAGTGGGAAGAACCCTGCC -3'

Sequencing Primer
(F):5'- AGGGCAATCTCTTGGAGTCAC -3'
(R):5'- gtttctttacccctctcagcc -3'
Posted On2014-05-14