Incidental Mutation 'R1722:Trim9'
ID191571
Institutional Source Beutler Lab
Gene Symbol Trim9
Ensembl Gene ENSMUSG00000021071
Gene Nametripartite motif-containing 9
Synonyms
MMRRC Submission 039754-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R1722 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location70244533-70347614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70248374 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 658 (N658S)
Ref Sequence ENSEMBL: ENSMUSP00000106149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110520] [ENSMUST00000110522] [ENSMUST00000222316] [ENSMUST00000223160]
Predicted Effect probably benign
Transcript: ENSMUST00000110520
AA Change: N658S

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106149
Gene: ENSMUSG00000021071
AA Change: N658S

DomainStartEndE-ValueType
RING 10 131 1.23e-4 SMART
BBOX 163 212 2.84e-9 SMART
BBOX 224 266 9.89e-9 SMART
BBC 273 399 1.29e-38 SMART
FN3 439 522 4.09e-7 SMART
Pfam:SPRY 598 702 2.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110522
AA Change: N732S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000106151
Gene: ENSMUSG00000021071
AA Change: N732S

DomainStartEndE-ValueType
RING 10 131 1.23e-4 SMART
BBOX 163 212 2.84e-9 SMART
BBOX 224 266 9.89e-9 SMART
BBC 273 399 1.29e-38 SMART
FN3 439 522 4.09e-7 SMART
low complexity region 591 605 N/A INTRINSIC
Pfam:SPRY 674 776 1.5e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000221294
AA Change: N704S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222173
Predicted Effect probably benign
Transcript: ENSMUST00000222316
AA Change: N750S

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000223160
AA Change: N654S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223518
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. Its function has not been identified. Alternate splicing of this gene generates two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display increased axonal branching and increased corpus callosum thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931422A03Rik A T 2: 103,993,928 probably null Het
Adssl1 A T 12: 112,636,481 I346F possibly damaging Het
Ahnak T A 19: 9,010,655 L3101H probably damaging Het
Aldh3b3 A G 19: 3,964,871 I123V possibly damaging Het
Angptl1 C T 1: 156,857,085 P275S possibly damaging Het
Apoa5 C T 9: 46,270,549 Q308* probably null Het
Arhgef12 T C 9: 43,020,717 *106W probably null Het
Atp2c1 A G 9: 105,439,400 Y485H probably benign Het
Atp6v1b1 C T 6: 83,743,092 T3I possibly damaging Het
Btbd7 A T 12: 102,812,654 I451N possibly damaging Het
Clasp1 T G 1: 118,590,464 L1080R probably damaging Het
Clec4f A G 6: 83,646,933 V408A probably benign Het
Clint1 T A 11: 45,906,406 M438K possibly damaging Het
Cuzd1 A T 7: 131,311,644 Y415N probably damaging Het
Ddias A G 7: 92,860,042 F222L possibly damaging Het
Efcab7 A T 4: 99,900,618 T321S probably benign Het
Elp3 A T 14: 65,551,397 D393E probably benign Het
Fbn2 T C 18: 58,048,052 probably null Het
Fcgr3 T C 1: 171,054,119 R146G possibly damaging Het
Fkrp G A 7: 16,810,794 A381V probably benign Het
Gatad2b T G 3: 90,355,679 I476S probably damaging Het
Gm1527 C T 3: 28,921,634 H557Y probably benign Het
Gm2431 A T 7: 142,257,862 C102S unknown Het
Hoxd13 A G 2: 74,670,045 N310S probably benign Het
Il9 T A 13: 56,479,395 T135S probably benign Het
Ints4 A C 7: 97,513,579 N476T probably benign Het
Kcnq4 A C 4: 120,702,427 D525E probably benign Het
Kncn A T 4: 115,885,899 Y57F probably damaging Het
Lpl TGG TG 8: 68,896,602 probably null Het
Lrrfip2 A G 9: 111,199,761 T351A probably damaging Het
Madd T C 2: 91,167,637 E682G probably benign Het
March7 A C 2: 60,234,182 R267S probably damaging Het
Mmp16 T A 4: 18,051,767 L252Q probably damaging Het
Mri1 A T 8: 84,253,925 V296D possibly damaging Het
Myo3a A G 2: 22,399,827 T665A probably benign Het
N4bp2 T C 5: 65,806,882 V758A probably benign Het
Nbea T C 3: 55,665,695 D2489G probably damaging Het
Neb T C 2: 52,256,745 T2836A probably damaging Het
Nedd4l T A 18: 65,157,939 V203E probably damaging Het
Nkpd1 C A 7: 19,523,921 Q392K possibly damaging Het
Nploc4 G T 11: 120,382,569 A576E probably benign Het
Nxph1 T A 6: 9,247,516 N162K probably damaging Het
Olfr1356 T A 10: 78,846,971 T315S probably benign Het
Olfr410 T C 11: 74,334,445 Y262C probably damaging Het
Pabpc2 T G 18: 39,775,116 I478S probably benign Het
Pde7b G T 10: 20,436,244 H190Q probably damaging Het
Plekha2 A T 8: 25,042,960 S332T probably benign Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rasl11a A T 5: 146,845,242 H9L probably benign Het
Rer1 A T 4: 155,075,001 F177I probably damaging Het
Rinl T C 7: 28,792,244 L74P probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Rttn T C 18: 88,973,531 V78A probably benign Het
Skint5 A T 4: 113,846,311 probably null Het
Tenm2 A C 11: 36,008,103 Y2743D probably damaging Het
Tmem101 T C 11: 102,154,693 Y110C probably damaging Het
Ucp1 A T 8: 83,290,688 T36S probably benign Het
Vmn2r43 A G 7: 8,255,068 I382T probably damaging Het
Zfp142 C T 1: 74,569,776 R1620Q probably damaging Het
Zfp386 T C 12: 116,059,906 S380P probably damaging Het
Other mutations in Trim9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Trim9 APN 12 70347113 missense probably damaging 0.98
IGL01618:Trim9 APN 12 70248351 missense probably benign
IGL01794:Trim9 APN 12 70281880 missense probably damaging 1.00
IGL03101:Trim9 APN 12 70346654 missense probably damaging 1.00
IGL03184:Trim9 APN 12 70251221 missense probably damaging 0.99
E0354:Trim9 UTSW 12 70272459 missense probably benign 0.01
IGL03098:Trim9 UTSW 12 70280693 missense possibly damaging 0.95
R0518:Trim9 UTSW 12 70346585 missense probably damaging 0.99
R0622:Trim9 UTSW 12 70346604 missense probably damaging 1.00
R0941:Trim9 UTSW 12 70248263 missense probably damaging 0.97
R1022:Trim9 UTSW 12 70252017 splice site probably null
R1024:Trim9 UTSW 12 70252017 splice site probably null
R1204:Trim9 UTSW 12 70346727 missense probably damaging 1.00
R1439:Trim9 UTSW 12 70251093 missense probably damaging 1.00
R1530:Trim9 UTSW 12 70272428 missense probably damaging 0.98
R1613:Trim9 UTSW 12 70248395 missense probably damaging 1.00
R1661:Trim9 UTSW 12 70255113 missense probably damaging 0.99
R1665:Trim9 UTSW 12 70255113 missense probably damaging 0.99
R2097:Trim9 UTSW 12 70347159 missense probably damaging 1.00
R3082:Trim9 UTSW 12 70255113 missense possibly damaging 0.93
R3123:Trim9 UTSW 12 70248393 missense probably damaging 1.00
R3124:Trim9 UTSW 12 70248393 missense probably damaging 1.00
R3125:Trim9 UTSW 12 70248393 missense probably damaging 1.00
R3738:Trim9 UTSW 12 70251195 missense probably damaging 1.00
R4013:Trim9 UTSW 12 70346352 missense probably damaging 1.00
R4017:Trim9 UTSW 12 70346352 missense probably damaging 1.00
R4560:Trim9 UTSW 12 70347118 nonsense probably null
R4734:Trim9 UTSW 12 70248273 missense probably damaging 1.00
R4748:Trim9 UTSW 12 70248273 missense probably damaging 1.00
R4749:Trim9 UTSW 12 70248273 missense probably damaging 1.00
R4777:Trim9 UTSW 12 70347071 missense probably damaging 1.00
R5027:Trim9 UTSW 12 70346708 missense probably damaging 0.96
R5451:Trim9 UTSW 12 70346829 missense probably benign 0.17
R5471:Trim9 UTSW 12 70346792 missense possibly damaging 0.93
R6394:Trim9 UTSW 12 70255213 missense possibly damaging 0.91
R6901:Trim9 UTSW 12 70346639 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCAGCCAGTCTGTTGAAGTCATTC -3'
(R):5'- GGTAAAAGCCAGCGGCAAACTC -3'

Sequencing Primer
(F):5'- CTGTTGAAGTCATTCAGGTCTAC -3'
(R):5'- CTACTATACATGGGGCCAAGTTC -3'
Posted On2014-05-14