Incidental Mutation 'R1723:St18'
ID191587
Institutional Source Beutler Lab
Gene Symbol St18
Ensembl Gene ENSMUSG00000033740
Gene Namesuppression of tumorigenicity 18
SynonymsNzf3, Myt3
MMRRC Submission 039755-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1723 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location6487231-6860940 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 6810685 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043578] [ENSMUST00000131494] [ENSMUST00000140079] [ENSMUST00000150761] [ENSMUST00000151281] [ENSMUST00000163727]
Predicted Effect probably benign
Transcript: ENSMUST00000043578
SMART Domains Protein: ENSMUSP00000042056
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 365 392 7.8e-15 PFAM
Pfam:zf-C2HC 409 437 4.2e-17 PFAM
Pfam:MYT1 476 713 1.3e-75 PFAM
Pfam:zf-C2HC 721 749 4e-19 PFAM
Pfam:zf-C2HC 765 793 1.7e-19 PFAM
Pfam:zf-C2HC 813 841 1.1e-17 PFAM
Pfam:zf-C2HC 866 893 9.1e-15 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131494
SMART Domains Protein: ENSMUSP00000117789
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132207
Predicted Effect probably benign
Transcript: ENSMUST00000140079
SMART Domains Protein: ENSMUSP00000118322
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150761
SMART Domains Protein: ENSMUSP00000120298
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151281
SMART Domains Protein: ENSMUSP00000122055
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163727
SMART Domains Protein: ENSMUSP00000131417
Gene: ENSMUSG00000033740

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 365 392 7.8e-15 PFAM
Pfam:zf-C2HC 409 437 4.2e-17 PFAM
Pfam:MYT1 476 713 1.3e-75 PFAM
Pfam:zf-C2HC 721 749 4e-19 PFAM
Pfam:zf-C2HC 765 793 1.7e-19 PFAM
Pfam:zf-C2HC 813 841 1.1e-17 PFAM
Pfam:zf-C2HC 866 893 9.1e-15 PFAM
coiled coil region 918 987 N/A INTRINSIC
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 G T 6: 85,628,753 G2462C probably damaging Het
Anapc5 T C 5: 122,799,343 E464G probably damaging Het
Aoc3 T A 11: 101,336,435 V378E possibly damaging Het
Atp13a5 T A 16: 29,232,799 K1152I possibly damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC027072 A T 17: 71,750,378 F768Y probably damaging Het
Calcoco1 C A 15: 102,719,553 G49C probably damaging Het
Cbwd1 A G 19: 24,948,094 V166A possibly damaging Het
Cd70 T C 17: 57,146,401 T88A possibly damaging Het
Cpeb1 C T 7: 81,436,226 R56Q probably benign Het
Dglucy A G 12: 100,842,679 Y212C probably damaging Het
Dnhd1 C A 7: 105,714,920 P4160T possibly damaging Het
Ecel1 T C 1: 87,154,421 D190G probably benign Het
Exoc6b A G 6: 85,069,344 L21P probably damaging Het
Fam110c A G 12: 31,074,395 R119G unknown Het
Fam198b T A 3: 79,936,663 N32K probably benign Het
Gm42791 C A 5: 148,959,501 probably benign Het
Hpcal4 A G 4: 123,190,739 I154V probably benign Het
Itgb1 A G 8: 128,726,038 D728G probably damaging Het
Kdm5d A T Y: 927,753 D701V probably damaging Het
Kif18a A G 2: 109,302,882 K448E probably damaging Het
Kif26a T C 12: 112,173,858 F507S possibly damaging Het
Kmt2c C T 5: 25,315,005 G2036R probably damaging Het
Lrrc43 T A 5: 123,492,213 probably benign Het
Map3k20 T C 2: 72,389,492 I256T probably damaging Het
Med29 T A 7: 28,392,705 probably benign Het
Mob3b A G 4: 34,954,026 C215R probably damaging Het
Mtf2 T C 5: 108,088,070 Y87H probably damaging Het
Myo18a G A 11: 77,853,314 R1834K probably damaging Het
Nlrc4 T A 17: 74,441,908 D779V probably damaging Het
Olfr638 T C 7: 104,003,311 F18S probably damaging Het
Otud3 T C 4: 138,898,018 T242A probably damaging Het
Pnliprp1 T A 19: 58,732,142 M150K possibly damaging Het
Polm T A 11: 5,834,776 Q227L probably benign Het
Poln A G 5: 34,122,672 V282A probably benign Het
Ppfia2 T A 10: 106,915,672 probably null Het
Rad51 T G 2: 119,123,814 M168R probably benign Het
Senp2 A G 16: 22,028,042 T266A probably benign Het
Sfswap A G 5: 129,539,694 T401A probably benign Het
Slc35a4 C A 18: 36,682,735 T206K possibly damaging Het
Slc40a1 A G 1: 45,924,761 S23P probably damaging Het
Spef2 T C 15: 9,614,209 K1217R probably damaging Het
Tdrd6 T C 17: 43,628,327 D610G possibly damaging Het
Tmem163 C A 1: 127,551,371 R137L probably damaging Het
Tmem94 T A 11: 115,794,748 D942E probably damaging Het
Ttn T A 2: 76,750,410 I23380F possibly damaging Het
Uckl1 T A 2: 181,570,600 probably null Het
Vav2 T C 2: 27,318,964 D99G possibly damaging Het
Vmn2r30 T A 7: 7,334,260 I126F probably benign Het
Zbtb41 A T 1: 139,423,563 Q138L probably benign Het
Zfp599 T C 9: 22,258,065 Y37C probably damaging Het
Zfp784 T A 7: 5,035,783 T259S possibly damaging Het
Zfp954 T C 7: 7,115,838 S236G probably benign Het
Other mutations in St18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:St18 APN 1 6802572 missense probably benign 0.07
IGL00840:St18 APN 1 6833594 missense probably damaging 1.00
IGL01016:St18 APN 1 6844323 missense probably damaging 0.98
IGL01116:St18 APN 1 6802632 missense probably damaging 0.96
IGL01719:St18 APN 1 6845796 splice site probably benign
IGL01885:St18 APN 1 6844372 critical splice donor site probably null
IGL02486:St18 APN 1 6820083 missense probably damaging 1.00
IGL02611:St18 APN 1 6768890 splice site probably benign
IGL02742:St18 APN 1 6802316 splice site probably benign
IGL02953:St18 APN 1 6844113 splice site probably benign
IGL02999:St18 APN 1 6817605 missense probably benign 0.01
IGL03092:St18 APN 1 6768894 splice site probably benign
Smallish UTSW 1 6855473 critical splice donor site probably null
IGL03055:St18 UTSW 1 6802735 missense probably damaging 0.99
R0089:St18 UTSW 1 6848948 missense probably benign 0.02
R0257:St18 UTSW 1 6819962 missense probably benign 0.04
R0383:St18 UTSW 1 6803024 missense probably damaging 1.00
R0588:St18 UTSW 1 6817738 missense probably damaging 0.99
R0989:St18 UTSW 1 6827881 missense probably benign 0.04
R1068:St18 UTSW 1 6795562 missense probably benign 0.01
R1311:St18 UTSW 1 6845644 missense probably damaging 1.00
R1530:St18 UTSW 1 6845569 critical splice acceptor site probably null
R1926:St18 UTSW 1 6802689 missense probably benign 0.00
R1927:St18 UTSW 1 6802712 missense probably benign 0.00
R2035:St18 UTSW 1 6802328 missense probably benign 0.00
R2091:St18 UTSW 1 6827971 missense probably benign 0.08
R2139:St18 UTSW 1 6810615 missense possibly damaging 0.85
R2261:St18 UTSW 1 6845572 missense probably damaging 0.96
R2300:St18 UTSW 1 6855402 missense probably damaging 1.00
R2322:St18 UTSW 1 6844124 nonsense probably null
R2846:St18 UTSW 1 6845587 missense probably damaging 0.96
R3738:St18 UTSW 1 6855473 critical splice donor site probably null
R3739:St18 UTSW 1 6855473 critical splice donor site probably null
R3772:St18 UTSW 1 6844329 missense probably damaging 1.00
R3805:St18 UTSW 1 6802353 missense probably damaging 1.00
R3953:St18 UTSW 1 6802893 missense probably damaging 0.99
R4034:St18 UTSW 1 6855473 critical splice donor site probably null
R4036:St18 UTSW 1 6827786 missense probably damaging 1.00
R4407:St18 UTSW 1 6827837 missense probably benign 0.29
R4527:St18 UTSW 1 6855423 missense probably damaging 1.00
R4740:St18 UTSW 1 6817604 missense probably benign
R4838:St18 UTSW 1 6802905 missense probably benign 0.01
R5182:St18 UTSW 1 6817653 missense probably benign 0.03
R5186:St18 UTSW 1 6802317 splice site probably null
R5354:St18 UTSW 1 6844171 missense probably damaging 1.00
R5423:St18 UTSW 1 6802616 missense possibly damaging 0.91
R5724:St18 UTSW 1 6770950 missense probably benign 0.13
R6182:St18 UTSW 1 6844118 splice site probably null
R6491:St18 UTSW 1 6827985 nonsense probably null
R6503:St18 UTSW 1 6795397 missense probably damaging 1.00
R7037:St18 UTSW 1 6803036 missense possibly damaging 0.65
R7098:St18 UTSW 1 6827842 missense not run
R7132:St18 UTSW 1 6859127 missense not run
R7144:St18 UTSW 1 6833594 missense not run
R7150:St18 UTSW 1 6803019 missense not run
Predicted Primers PCR Primer
(F):5'- AAGGCAGACCACATTGTCACGC -3'
(R):5'- TTCTTCCAGGCAGGAAAGAAACCAG -3'

Sequencing Primer
(F):5'- ACATTGTCACGCTCACTCAC -3'
(R):5'- GGAGCCCACCTGTTATTACATTAG -3'
Posted On2014-05-14