Incidental Mutation 'R1723:Cbwd1'
ID191645
Institutional Source Beutler Lab
Gene Symbol Cbwd1
Ensembl Gene ENSMUSG00000024878
Gene NameCOBW domain containing 1
Synonyms
MMRRC Submission 039755-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R1723 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location24919916-24961616 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24948094 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 166 (V166A)
Ref Sequence ENSEMBL: ENSMUSP00000025815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025815]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025815
AA Change: V166A

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025815
Gene: ENSMUSG00000024878
AA Change: V166A

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
Pfam:cobW 41 229 7.1e-51 PFAM
CobW_C 271 374 5.34e-1 SMART
Meta Mutation Damage Score 0.0596 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 G T 6: 85,628,753 G2462C probably damaging Het
Anapc5 T C 5: 122,799,343 E464G probably damaging Het
Aoc3 T A 11: 101,336,435 V378E possibly damaging Het
Atp13a5 T A 16: 29,232,799 K1152I possibly damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC027072 A T 17: 71,750,378 F768Y probably damaging Het
Calcoco1 C A 15: 102,719,553 G49C probably damaging Het
Cd70 T C 17: 57,146,401 T88A possibly damaging Het
Cpeb1 C T 7: 81,436,226 R56Q probably benign Het
Dglucy A G 12: 100,842,679 Y212C probably damaging Het
Dnhd1 C A 7: 105,714,920 P4160T possibly damaging Het
Ecel1 T C 1: 87,154,421 D190G probably benign Het
Exoc6b A G 6: 85,069,344 L21P probably damaging Het
Fam110c A G 12: 31,074,395 R119G unknown Het
Fam198b T A 3: 79,936,663 N32K probably benign Het
Gm42791 C A 5: 148,959,501 probably benign Het
Hpcal4 A G 4: 123,190,739 I154V probably benign Het
Itgb1 A G 8: 128,726,038 D728G probably damaging Het
Kdm5d A T Y: 927,753 D701V probably damaging Het
Kif18a A G 2: 109,302,882 K448E probably damaging Het
Kif26a T C 12: 112,173,858 F507S possibly damaging Het
Kmt2c C T 5: 25,315,005 G2036R probably damaging Het
Lrrc43 T A 5: 123,492,213 probably benign Het
Map3k20 T C 2: 72,389,492 I256T probably damaging Het
Med29 T A 7: 28,392,705 probably benign Het
Mob3b A G 4: 34,954,026 C215R probably damaging Het
Mtf2 T C 5: 108,088,070 Y87H probably damaging Het
Myo18a G A 11: 77,853,314 R1834K probably damaging Het
Nlrc4 T A 17: 74,441,908 D779V probably damaging Het
Olfr638 T C 7: 104,003,311 F18S probably damaging Het
Otud3 T C 4: 138,898,018 T242A probably damaging Het
Pnliprp1 T A 19: 58,732,142 M150K possibly damaging Het
Polm T A 11: 5,834,776 Q227L probably benign Het
Poln A G 5: 34,122,672 V282A probably benign Het
Ppfia2 T A 10: 106,915,672 probably null Het
Rad51 T G 2: 119,123,814 M168R probably benign Het
Senp2 A G 16: 22,028,042 T266A probably benign Het
Sfswap A G 5: 129,539,694 T401A probably benign Het
Slc35a4 C A 18: 36,682,735 T206K possibly damaging Het
Slc40a1 A G 1: 45,924,761 S23P probably damaging Het
Spef2 T C 15: 9,614,209 K1217R probably damaging Het
St18 A C 1: 6,810,685 probably benign Het
Tdrd6 T C 17: 43,628,327 D610G possibly damaging Het
Tmem163 C A 1: 127,551,371 R137L probably damaging Het
Tmem94 T A 11: 115,794,748 D942E probably damaging Het
Ttn T A 2: 76,750,410 I23380F possibly damaging Het
Uckl1 T A 2: 181,570,600 probably null Het
Vav2 T C 2: 27,318,964 D99G possibly damaging Het
Vmn2r30 T A 7: 7,334,260 I126F probably benign Het
Zbtb41 A T 1: 139,423,563 Q138L probably benign Het
Zfp599 T C 9: 22,258,065 Y37C probably damaging Het
Zfp784 T A 7: 5,035,783 T259S possibly damaging Het
Zfp954 T C 7: 7,115,838 S236G probably benign Het
Other mutations in Cbwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00720:Cbwd1 APN 19 24921131 missense probably benign 0.01
IGL01618:Cbwd1 APN 19 24940776 missense possibly damaging 0.83
IGL02351:Cbwd1 APN 19 24931662 critical splice donor site probably null
IGL02358:Cbwd1 APN 19 24931662 critical splice donor site probably null
IGL02628:Cbwd1 APN 19 24957905 missense probably damaging 1.00
IGL03001:Cbwd1 APN 19 24922638 missense probably benign 0.01
IGL03053:Cbwd1 APN 19 24955377 missense probably damaging 1.00
IGL03409:Cbwd1 APN 19 24922766 missense probably benign 0.01
R0544:Cbwd1 UTSW 19 24949211 missense possibly damaging 0.79
R0655:Cbwd1 UTSW 19 24953320 missense possibly damaging 0.90
R0833:Cbwd1 UTSW 19 24940839 splice site probably benign
R1296:Cbwd1 UTSW 19 24942675 splice site probably benign
R1888:Cbwd1 UTSW 19 24955405 missense probably damaging 1.00
R1888:Cbwd1 UTSW 19 24955405 missense probably damaging 1.00
R4526:Cbwd1 UTSW 19 24957964 missense probably benign 0.20
R5092:Cbwd1 UTSW 19 24921019 critical splice donor site probably null
R5238:Cbwd1 UTSW 19 24920630 missense probably damaging 0.99
R5852:Cbwd1 UTSW 19 24955405 missense possibly damaging 0.89
R7248:Cbwd1 UTSW 19 24921141 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTCACTTGAAAACCTGGGAAATGCTG -3'
(R):5'- TCCTGAGGTTGAGTTAAATTGCCACAC -3'

Sequencing Primer
(F):5'- CCAATAATGGGAATGGATTCTAGTG -3'
(R):5'- ATTGCCACACTGATTAGAGAAAAA -3'
Posted On2014-05-14