Incidental Mutation 'R1724:Erich3'
ID191660
Institutional Source Beutler Lab
Gene Symbol Erich3
Ensembl Gene ENSMUSG00000078161
Gene Nameglutamate rich 3
Synonyms4922501L14Rik
MMRRC Submission 039756-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R1724 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location154663859-154767790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 154762327 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 805 (D805E)
Ref Sequence ENSEMBL: ENSMUSP00000096097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098496] [ENSMUST00000189969]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098496
AA Change: D805E

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096097
Gene: ENSMUSG00000078161
AA Change: D805E

DomainStartEndE-ValueType
internal_repeat_1 18 102 3.73e-10 PROSPERO
internal_repeat_1 155 240 3.73e-10 PROSPERO
low complexity region 501 514 N/A INTRINSIC
low complexity region 756 773 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189969
SMART Domains Protein: ENSMUSP00000140929
Gene: ENSMUSG00000078161

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
Meta Mutation Damage Score 0.0516 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 T C 2: 26,991,294 V761A probably benign Het
Arap1 G T 7: 101,400,526 A1032S possibly damaging Het
Atg4d C T 9: 21,268,445 H230Y probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bcdin3d T A 15: 99,470,680 K213* probably null Het
Cep295nl T A 11: 118,333,028 E330V probably benign Het
Col10a1 A G 10: 34,395,718 Y562C probably damaging Het
Col9a2 G A 4: 121,053,902 R578Q probably damaging Het
Creld1 A G 6: 113,484,574 D85G possibly damaging Het
Cth A T 3: 157,913,727 V153D probably damaging Het
Dazap2 T A 15: 100,618,003 Y71N probably damaging Het
Ddah1 A C 3: 145,891,506 D269A probably damaging Het
Dhx9 A C 1: 153,458,488 D975E probably benign Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Gabpb2 T C 3: 95,206,515 D19G probably damaging Het
Gabrr1 T A 4: 33,161,651 M325K probably damaging Het
Galntl5 T G 5: 25,220,122 N379K possibly damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm21964 C A 8: 110,110,163 T227N probably damaging Het
Gm42791 C A 5: 148,959,501 probably benign Het
Gm5356 G A 8: 89,187,056 noncoding transcript Het
Kifap3 C T 1: 163,783,097 R49* probably null Het
Kmt2c C T 5: 25,315,005 G2036R probably damaging Het
Lce1l A T 3: 92,850,419 V44E unknown Het
Lmbr1 T A 5: 29,361,083 E48D probably benign Het
Nes C A 3: 87,977,441 N958K probably benign Het
Nwd1 A C 8: 72,711,620 H1432P probably damaging Het
Olfr651 T C 7: 104,553,228 F103S probably damaging Het
Olfr715b G A 7: 107,106,202 H220Y probably benign Het
Osgepl1 A G 1: 53,317,903 T75A probably benign Het
Perm1 T C 4: 156,218,072 S358P possibly damaging Het
Pramef17 C T 4: 143,993,432 G121D probably benign Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Sdc4 G T 2: 164,431,286 Q35K probably benign Het
Secisbp2 A G 13: 51,670,846 S377G probably benign Het
Spag16 G C 1: 70,493,782 G540A probably damaging Het
Sun1 T A 5: 139,235,725 D517E probably benign Het
Taf3 A G 2: 9,952,366 V177A probably benign Het
Thbs2 A G 17: 14,685,900 L246P possibly damaging Het
Trpm1 G T 7: 64,235,821 G862* probably null Het
Trpm8 A T 1: 88,350,856 T584S possibly damaging Het
Ythdc2 T C 18: 44,828,690 S2P probably benign Het
Zc2hc1c G T 12: 85,289,812 R81L probably benign Het
Zfp292 C A 4: 34,811,237 L602F probably damaging Het
Other mutations in Erich3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Erich3 APN 3 154748519 missense probably benign 0.44
IGL01141:Erich3 APN 3 154714016 missense probably benign 0.08
IGL01812:Erich3 APN 3 154713971 missense possibly damaging 0.70
IGL02126:Erich3 APN 3 154713962 missense possibly damaging 0.60
IGL03371:Erich3 APN 3 154727477 missense probably damaging 0.97
IGL03386:Erich3 APN 3 154739239 missense possibly damaging 0.80
FR4449:Erich3 UTSW 3 154763513 unclassified probably benign
R0942:Erich3 UTSW 3 154739151 missense probably benign 0.00
R1558:Erich3 UTSW 3 154714068 missense probably damaging 0.99
R1582:Erich3 UTSW 3 154764323 unclassified probably benign
R1674:Erich3 UTSW 3 154762623 unclassified probably benign
R1676:Erich3 UTSW 3 154762623 unclassified probably benign
R1757:Erich3 UTSW 3 154695765 missense probably damaging 0.98
R1771:Erich3 UTSW 3 154748472 missense possibly damaging 0.82
R2384:Erich3 UTSW 3 154764651 missense possibly damaging 0.92
R2410:Erich3 UTSW 3 154733603 missense probably damaging 0.98
R2507:Erich3 UTSW 3 154698659 missense probably null 1.00
R3621:Erich3 UTSW 3 154748732 missense possibly damaging 0.83
R3755:Erich3 UTSW 3 154764321 unclassified probably benign
R3756:Erich3 UTSW 3 154764321 unclassified probably benign
R3756:Erich3 UTSW 3 154764578 missense possibly damaging 0.66
R3832:Erich3 UTSW 3 154762361 missense probably damaging 0.97
R4020:Erich3 UTSW 3 154714049 missense probably damaging 0.97
R4601:Erich3 UTSW 3 154764738 missense unknown
R4628:Erich3 UTSW 3 154763687 missense probably damaging 1.00
R4841:Erich3 UTSW 3 154704843 missense possibly damaging 0.87
R4842:Erich3 UTSW 3 154704843 missense possibly damaging 0.87
R4863:Erich3 UTSW 3 154764804 missense unknown
R4989:Erich3 UTSW 3 154748388 missense possibly damaging 0.85
R5310:Erich3 UTSW 3 154763580 missense probably damaging 1.00
R5596:Erich3 UTSW 3 154727396 missense probably damaging 0.99
R5695:Erich3 UTSW 3 154733573 missense probably damaging 1.00
R5742:Erich3 UTSW 3 154733323 missense probably damaging 1.00
R5859:Erich3 UTSW 3 154762497 missense possibly damaging 0.90
R5916:Erich3 UTSW 3 154695823 missense probably damaging 1.00
R6172:Erich3 UTSW 3 154764341 missense possibly damaging 0.66
R6321:Erich3 UTSW 3 154727502 missense probably damaging 1.00
R6438:Erich3 UTSW 3 154695753 missense probably damaging 1.00
R6520:Erich3 UTSW 3 154763465 missense probably damaging 0.98
R6679:Erich3 UTSW 3 154762429 missense possibly damaging 0.81
R6697:Erich3 UTSW 3 154764270 unclassified probably benign
R6800:Erich3 UTSW 3 154727392 critical splice acceptor site probably null
R6823:Erich3 UTSW 3 154727437 missense probably damaging 1.00
R6855:Erich3 UTSW 3 154762649 nonsense probably null
R6989:Erich3 UTSW 3 154763677 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGCAGCCATCAGCGCAAATGAG -3'
(R):5'- CCAGTTCCACATCCATGTCAGCATC -3'

Sequencing Primer
(F):5'- GCGCAAATGAGCAACCAG -3'
(R):5'- AGTTCTACATCCATGTCAGCATC -3'
Posted On2014-05-14