Incidental Mutation 'R1724:Gabrr1'
ID191662
Institutional Source Beutler Lab
Gene Symbol Gabrr1
Ensembl Gene ENSMUSG00000028280
Gene Namegamma-aminobutyric acid (GABA) C receptor, subunit rho 1
SynonymsGABA-C
MMRRC Submission 039756-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R1724 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location33132521-33163588 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33161651 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 325 (M325K)
Ref Sequence ENSEMBL: ENSMUSP00000029947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029947]
Predicted Effect probably damaging
Transcript: ENSMUST00000029947
AA Change: M325K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029947
Gene: ENSMUSG00000028280
AA Change: M325K

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 69 276 4.8e-53 PFAM
Pfam:Neur_chan_memb 283 402 3.1e-33 PFAM
transmembrane domain 453 472 N/A INTRINSIC
Meta Mutation Damage Score 0.39 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA receptors, which are ligand-gated chloride channels. GABRR1 is a member of the rho subunit family. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a knock-out allele display altered visual processing in the retina. Mice homozygous for a different knock-out allele exhibit alterations of mechanical pain sensitivity, GABA-inhibited spinal cord responses, and olfactory function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 T C 2: 26,991,294 V761A probably benign Het
Arap1 G T 7: 101,400,526 A1032S possibly damaging Het
Atg4d C T 9: 21,268,445 H230Y probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bcdin3d T A 15: 99,470,680 K213* probably null Het
Cep295nl T A 11: 118,333,028 E330V probably benign Het
Col10a1 A G 10: 34,395,718 Y562C probably damaging Het
Col9a2 G A 4: 121,053,902 R578Q probably damaging Het
Creld1 A G 6: 113,484,574 D85G possibly damaging Het
Cth A T 3: 157,913,727 V153D probably damaging Het
Dazap2 T A 15: 100,618,003 Y71N probably damaging Het
Ddah1 A C 3: 145,891,506 D269A probably damaging Het
Dhx9 A C 1: 153,458,488 D975E probably benign Het
Erich3 T A 3: 154,762,327 D805E possibly damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Gabpb2 T C 3: 95,206,515 D19G probably damaging Het
Galntl5 T G 5: 25,220,122 N379K possibly damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm21964 C A 8: 110,110,163 T227N probably damaging Het
Gm42791 C A 5: 148,959,501 probably benign Het
Gm5356 G A 8: 89,187,056 noncoding transcript Het
Kifap3 C T 1: 163,783,097 R49* probably null Het
Kmt2c C T 5: 25,315,005 G2036R probably damaging Het
Lce1l A T 3: 92,850,419 V44E unknown Het
Lmbr1 T A 5: 29,361,083 E48D probably benign Het
Nes C A 3: 87,977,441 N958K probably benign Het
Nwd1 A C 8: 72,711,620 H1432P probably damaging Het
Olfr651 T C 7: 104,553,228 F103S probably damaging Het
Olfr715b G A 7: 107,106,202 H220Y probably benign Het
Osgepl1 A G 1: 53,317,903 T75A probably benign Het
Perm1 T C 4: 156,218,072 S358P possibly damaging Het
Pramef17 C T 4: 143,993,432 G121D probably benign Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Sdc4 G T 2: 164,431,286 Q35K probably benign Het
Secisbp2 A G 13: 51,670,846 S377G probably benign Het
Spag16 G C 1: 70,493,782 G540A probably damaging Het
Sun1 T A 5: 139,235,725 D517E probably benign Het
Taf3 A G 2: 9,952,366 V177A probably benign Het
Thbs2 A G 17: 14,685,900 L246P possibly damaging Het
Trpm1 G T 7: 64,235,821 G862* probably null Het
Trpm8 A T 1: 88,350,856 T584S possibly damaging Het
Ythdc2 T C 18: 44,828,690 S2P probably benign Het
Zc2hc1c G T 12: 85,289,812 R81L probably benign Het
Zfp292 C A 4: 34,811,237 L602F probably damaging Het
Other mutations in Gabrr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01617:Gabrr1 APN 4 33162634 missense probably benign
IGL02052:Gabrr1 APN 4 33152567 missense probably damaging 0.98
IGL02169:Gabrr1 APN 4 33160261 missense probably damaging 1.00
IGL02834:Gabrr1 APN 4 33151426 missense probably damaging 1.00
R0135:Gabrr1 UTSW 4 33160224 missense probably damaging 1.00
R0606:Gabrr1 UTSW 4 33132696 missense probably benign 0.30
R0739:Gabrr1 UTSW 4 33162781 missense probably benign 0.08
R0843:Gabrr1 UTSW 4 33161717 missense possibly damaging 0.93
R1182:Gabrr1 UTSW 4 33132680 missense probably benign
R1628:Gabrr1 UTSW 4 33152432 missense probably damaging 1.00
R2300:Gabrr1 UTSW 4 33152449 missense probably benign 0.01
R2405:Gabrr1 UTSW 4 33157110 missense probably damaging 1.00
R3424:Gabrr1 UTSW 4 33158058 missense probably damaging 1.00
R3500:Gabrr1 UTSW 4 33158184 splice site probably benign
R4575:Gabrr1 UTSW 4 33158175 missense possibly damaging 0.94
R4923:Gabrr1 UTSW 4 33162820 missense possibly damaging 0.59
R5686:Gabrr1 UTSW 4 33161684 missense probably damaging 0.98
R5941:Gabrr1 UTSW 4 33162676 missense probably benign 0.01
R6122:Gabrr1 UTSW 4 33161695 missense probably damaging 1.00
R6217:Gabrr1 UTSW 4 33149026 splice site probably null
R6232:Gabrr1 UTSW 4 33161632 missense probably benign 0.41
R6489:Gabrr1 UTSW 4 33162855 missense probably benign 0.02
R6793:Gabrr1 UTSW 4 33162712 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TACTCAAGGTCCTCCTTCTGGACG -3'
(R):5'- GGTAAAGTCACCTTCTCCCGAAGC -3'

Sequencing Primer
(F):5'- CCATGTGCTAAAATGTCTGGAGC -3'
(R):5'- AAGCTTCCGTTCCTTCCG -3'
Posted On2014-05-14