Incidental Mutation 'R1724:Col9a2'
ID191664
Institutional Source Beutler Lab
Gene Symbol Col9a2
Ensembl Gene ENSMUSG00000028626
Gene Namecollagen, type IX, alpha 2
SynonymsCol9a-2
MMRRC Submission 039756-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1724 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location121039385-121055322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 121053902 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 578 (R578Q)
Ref Sequence ENSEMBL: ENSMUSP00000030372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030372]
Predicted Effect probably damaging
Transcript: ENSMUST00000030372
AA Change: R578Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030372
Gene: ENSMUSG00000028626
AA Change: R578Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Collagen 24 82 7.3e-12 PFAM
Pfam:Collagen 59 115 2.4e-10 PFAM
Pfam:Collagen 113 170 2e-8 PFAM
Pfam:Collagen 176 236 8.9e-11 PFAM
low complexity region 258 277 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
Pfam:Collagen 357 435 4.4e-8 PFAM
Pfam:Collagen 459 523 6.1e-11 PFAM
Pfam:Collagen 548 610 4.5e-11 PFAM
low complexity region 639 661 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140119
Meta Mutation Damage Score 0.26 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 T C 2: 26,991,294 V761A probably benign Het
Arap1 G T 7: 101,400,526 A1032S possibly damaging Het
Atg4d C T 9: 21,268,445 H230Y probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bcdin3d T A 15: 99,470,680 K213* probably null Het
Cep295nl T A 11: 118,333,028 E330V probably benign Het
Col10a1 A G 10: 34,395,718 Y562C probably damaging Het
Creld1 A G 6: 113,484,574 D85G possibly damaging Het
Cth A T 3: 157,913,727 V153D probably damaging Het
Dazap2 T A 15: 100,618,003 Y71N probably damaging Het
Ddah1 A C 3: 145,891,506 D269A probably damaging Het
Dhx9 A C 1: 153,458,488 D975E probably benign Het
Erich3 T A 3: 154,762,327 D805E possibly damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Gabpb2 T C 3: 95,206,515 D19G probably damaging Het
Gabrr1 T A 4: 33,161,651 M325K probably damaging Het
Galntl5 T G 5: 25,220,122 N379K possibly damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm21964 C A 8: 110,110,163 T227N probably damaging Het
Gm42791 C A 5: 148,959,501 probably benign Het
Gm5356 G A 8: 89,187,056 noncoding transcript Het
Kifap3 C T 1: 163,783,097 R49* probably null Het
Kmt2c C T 5: 25,315,005 G2036R probably damaging Het
Lce1l A T 3: 92,850,419 V44E unknown Het
Lmbr1 T A 5: 29,361,083 E48D probably benign Het
Nes C A 3: 87,977,441 N958K probably benign Het
Nwd1 A C 8: 72,711,620 H1432P probably damaging Het
Olfr651 T C 7: 104,553,228 F103S probably damaging Het
Olfr715b G A 7: 107,106,202 H220Y probably benign Het
Osgepl1 A G 1: 53,317,903 T75A probably benign Het
Perm1 T C 4: 156,218,072 S358P possibly damaging Het
Pramef17 C T 4: 143,993,432 G121D probably benign Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Sdc4 G T 2: 164,431,286 Q35K probably benign Het
Secisbp2 A G 13: 51,670,846 S377G probably benign Het
Spag16 G C 1: 70,493,782 G540A probably damaging Het
Sun1 T A 5: 139,235,725 D517E probably benign Het
Taf3 A G 2: 9,952,366 V177A probably benign Het
Thbs2 A G 17: 14,685,900 L246P possibly damaging Het
Trpm1 G T 7: 64,235,821 G862* probably null Het
Trpm8 A T 1: 88,350,856 T584S possibly damaging Het
Ythdc2 T C 18: 44,828,690 S2P probably benign Het
Zc2hc1c G T 12: 85,289,812 R81L probably benign Het
Zfp292 C A 4: 34,811,237 L602F probably damaging Het
Other mutations in Col9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Col9a2 APN 4 121045192 missense possibly damaging 0.95
IGL01978:Col9a2 APN 4 121044666 missense unknown
IGL01995:Col9a2 APN 4 121050410 critical splice donor site probably null
IGL02162:Col9a2 APN 4 121054334 unclassified probably benign
IGL02931:Col9a2 APN 4 121053192 missense probably benign 0.06
R0208:Col9a2 UTSW 4 121052288 splice site probably benign
R0426:Col9a2 UTSW 4 121044660 splice site probably benign
R0512:Col9a2 UTSW 4 121054307 missense probably benign 0.22
R0973:Col9a2 UTSW 4 121039788 critical splice donor site probably null
R1023:Col9a2 UTSW 4 121044010 missense unknown
R1657:Col9a2 UTSW 4 121040974 missense unknown
R2171:Col9a2 UTSW 4 121045001 nonsense probably null
R2206:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2221:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2223:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2273:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2274:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2275:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2354:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2392:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2393:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2394:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3421:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3426:Col9a2 UTSW 4 121050407 missense possibly damaging 0.93
R3710:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3821:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3838:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3839:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R4067:Col9a2 UTSW 4 121052389 missense probably damaging 1.00
R4298:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R4299:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R4595:Col9a2 UTSW 4 121045155 missense probably benign 0.04
R4942:Col9a2 UTSW 4 121053119 missense possibly damaging 0.73
R5120:Col9a2 UTSW 4 121039772 missense unknown
R5434:Col9a2 UTSW 4 121040965 nonsense probably null
R6143:Col9a2 UTSW 4 121053863 missense probably damaging 0.99
R7027:Col9a2 UTSW 4 121044019 critical splice donor site probably null
R7056:Col9a2 UTSW 4 121049716 critical splice donor site probably null
R7417:Col9a2 UTSW 4 121054292 missense not run
R7571:Col9a2 UTSW 4 121039784 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGATGCACTGTCTTCTCCAGTCTC -3'
(R):5'- CCCAAACTGACAAGTCTTTCTCCCG -3'

Sequencing Primer
(F):5'- AGTCTCATCTTAGACCCTTCTTCG -3'
(R):5'- ATCCAGATAAGATTTGGGAGGTTC -3'
Posted On2014-05-14