Incidental Mutation 'R1724:Perm1'
ID191666
Institutional Source Beutler Lab
Gene Symbol Perm1
Ensembl Gene ENSMUSG00000078486
Gene NamePPARGC1 and ESRR induced regulator, muscle 1
Synonyms2310042D19Rik
MMRRC Submission 039756-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R1724 (G1)
Quality Score219
Status Validated
Chromosome4
Chromosomal Location156215868-156221307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 156218072 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 358 (S358P)
Ref Sequence ENSEMBL: ENSMUSP00000101197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105571] [ENSMUST00000105572] [ENSMUST00000217885] [ENSMUST00000218699]
Predicted Effect probably benign
Transcript: ENSMUST00000105571
SMART Domains Protein: ENSMUSP00000101196
Gene: ENSMUSG00000078485

DomainStartEndE-ValueType
PH 96 192 4.6e-4 SMART
PH 227 324 8.34e-2 SMART
low complexity region 346 359 N/A INTRINSIC
low complexity region 403 414 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105572
AA Change: S358P

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101197
Gene: ENSMUSG00000078486
AA Change: S358P

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
low complexity region 145 160 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 544 553 N/A INTRINSIC
low complexity region 606 616 N/A INTRINSIC
low complexity region 790 806 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217885
Predicted Effect probably benign
Transcript: ENSMUST00000218699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219227
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 T C 2: 26,991,294 V761A probably benign Het
Arap1 G T 7: 101,400,526 A1032S possibly damaging Het
Atg4d C T 9: 21,268,445 H230Y probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bcdin3d T A 15: 99,470,680 K213* probably null Het
Cep295nl T A 11: 118,333,028 E330V probably benign Het
Col10a1 A G 10: 34,395,718 Y562C probably damaging Het
Col9a2 G A 4: 121,053,902 R578Q probably damaging Het
Creld1 A G 6: 113,484,574 D85G possibly damaging Het
Cth A T 3: 157,913,727 V153D probably damaging Het
Dazap2 T A 15: 100,618,003 Y71N probably damaging Het
Ddah1 A C 3: 145,891,506 D269A probably damaging Het
Dhx9 A C 1: 153,458,488 D975E probably benign Het
Erich3 T A 3: 154,762,327 D805E possibly damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Gabpb2 T C 3: 95,206,515 D19G probably damaging Het
Gabrr1 T A 4: 33,161,651 M325K probably damaging Het
Galntl5 T G 5: 25,220,122 N379K possibly damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm21964 C A 8: 110,110,163 T227N probably damaging Het
Gm42791 C A 5: 148,959,501 probably benign Het
Gm5356 G A 8: 89,187,056 noncoding transcript Het
Kifap3 C T 1: 163,783,097 R49* probably null Het
Kmt2c C T 5: 25,315,005 G2036R probably damaging Het
Lce1l A T 3: 92,850,419 V44E unknown Het
Lmbr1 T A 5: 29,361,083 E48D probably benign Het
Nes C A 3: 87,977,441 N958K probably benign Het
Nwd1 A C 8: 72,711,620 H1432P probably damaging Het
Olfr651 T C 7: 104,553,228 F103S probably damaging Het
Olfr715b G A 7: 107,106,202 H220Y probably benign Het
Osgepl1 A G 1: 53,317,903 T75A probably benign Het
Pramef17 C T 4: 143,993,432 G121D probably benign Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Sdc4 G T 2: 164,431,286 Q35K probably benign Het
Secisbp2 A G 13: 51,670,846 S377G probably benign Het
Spag16 G C 1: 70,493,782 G540A probably damaging Het
Sun1 T A 5: 139,235,725 D517E probably benign Het
Taf3 A G 2: 9,952,366 V177A probably benign Het
Thbs2 A G 17: 14,685,900 L246P possibly damaging Het
Trpm1 G T 7: 64,235,821 G862* probably null Het
Trpm8 A T 1: 88,350,856 T584S possibly damaging Het
Ythdc2 T C 18: 44,828,690 S2P probably benign Het
Zc2hc1c G T 12: 85,289,812 R81L probably benign Het
Zfp292 C A 4: 34,811,237 L602F probably damaging Het
Other mutations in Perm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01967:Perm1 APN 4 156217661 missense probably damaging 0.99
IGL01970:Perm1 APN 4 156217661 missense probably damaging 0.99
IGL02143:Perm1 APN 4 156218043 missense probably benign 0.09
IGL02644:Perm1 APN 4 156218586 missense probably damaging 1.00
IGL02993:Perm1 APN 4 156217779 missense probably benign 0.20
R0052:Perm1 UTSW 4 156218115 missense probably damaging 1.00
R0105:Perm1 UTSW 4 156218225 missense probably benign 0.23
R0566:Perm1 UTSW 4 156217859 missense probably benign 0.10
R1184:Perm1 UTSW 4 156217314 missense probably damaging 1.00
R1208:Perm1 UTSW 4 156217002 start codon destroyed probably null 0.92
R1244:Perm1 UTSW 4 156217883 missense probably benign 0.09
R1783:Perm1 UTSW 4 156218531 nonsense probably null
R1817:Perm1 UTSW 4 156218604 missense possibly damaging 0.59
R1892:Perm1 UTSW 4 156217883 missense probably benign 0.09
R1893:Perm1 UTSW 4 156217883 missense probably benign 0.09
R2106:Perm1 UTSW 4 156218879 missense probably damaging 1.00
R2567:Perm1 UTSW 4 156217118 missense probably damaging 0.99
R3752:Perm1 UTSW 4 156217946 missense probably benign 0.01
R3934:Perm1 UTSW 4 156219170 missense probably benign
R4509:Perm1 UTSW 4 156217586 missense probably benign 0.02
R4667:Perm1 UTSW 4 156220206 nonsense probably null
R4706:Perm1 UTSW 4 156217074 missense probably damaging 0.99
R4812:Perm1 UTSW 4 156218736 missense possibly damaging 0.59
R4979:Perm1 UTSW 4 156217577 missense probably benign 0.01
R5275:Perm1 UTSW 4 156217518 missense probably benign
R5295:Perm1 UTSW 4 156217518 missense probably benign
R5425:Perm1 UTSW 4 156218295 missense probably benign 0.04
R6125:Perm1 UTSW 4 156217719 missense probably benign 0.00
R6573:Perm1 UTSW 4 156218673 missense probably damaging 1.00
R6721:Perm1 UTSW 4 156218319 missense probably benign 0.00
R6986:Perm1 UTSW 4 156218519 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGGTATCCAAACCTGTCCAGGAAG -3'
(R):5'- CACATGCAATCCAGGTGTGCAAG -3'

Sequencing Primer
(F):5'- GTCCAGGAAGTTCACCCAGATG -3'
(R):5'- TGTGCAAGCAGACGCAAATTC -3'
Posted On2014-05-14