Incidental Mutation 'R1724:Sun1'
ID191670
Institutional Source Beutler Lab
Gene Symbol Sun1
Ensembl Gene ENSMUSG00000036817
Gene NameSad1 and UNC84 domain containing 1
SynonymsUnc84a, 5730434D03Rik, 4632417G13Rik
MMRRC Submission 039756-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1724 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location139200637-139249840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139235725 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 517 (D517E)
Ref Sequence ENSEMBL: ENSMUSP00000106508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058716] [ENSMUST00000078690] [ENSMUST00000110882] [ENSMUST00000110883] [ENSMUST00000110884]
Predicted Effect probably benign
Transcript: ENSMUST00000058716
AA Change: D554E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000056655
Gene: ENSMUSG00000036817
AA Change: D554E

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 334 450 2e-3 SMART
low complexity region 466 475 N/A INTRINSIC
coiled coil region 492 527 N/A INTRINSIC
SCOP:d1eq1a_ 572 689 3e-3 SMART
Pfam:Sad1_UNC 777 911 2.2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078690
AA Change: D490E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077756
Gene: ENSMUSG00000036817
AA Change: D490E

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 270 386 2e-3 SMART
low complexity region 402 411 N/A INTRINSIC
coiled coil region 428 463 N/A INTRINSIC
SCOP:d1eq1a_ 508 625 2e-3 SMART
Pfam:Sad1_UNC 713 847 1.9e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110882
AA Change: D398E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106506
Gene: ENSMUSG00000036817
AA Change: D398E

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
low complexity region 263 271 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
coiled coil region 336 371 N/A INTRINSIC
SCOP:d1eq1a_ 416 533 4e-3 SMART
Pfam:Sad1_UNC 621 755 7.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110883
AA Change: D431E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106507
Gene: ENSMUSG00000036817
AA Change: D431E

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 233 327 4e-3 SMART
low complexity region 343 352 N/A INTRINSIC
coiled coil region 369 404 N/A INTRINSIC
SCOP:d1eq1a_ 449 566 3e-3 SMART
Pfam:Sad1_UNC 654 788 1.7e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110884
AA Change: D517E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106508
Gene: ENSMUSG00000036817
AA Change: D517E

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
Pfam:MRP 274 381 1.8e-8 PFAM
low complexity region 382 390 N/A INTRINSIC
low complexity region 429 438 N/A INTRINSIC
coiled coil region 455 490 N/A INTRINSIC
SCOP:d1eq1a_ 535 652 4e-3 SMART
Pfam:Sad1_UNC 740 874 2e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126108
Predicted Effect unknown
Transcript: ENSMUST00000128817
AA Change: D49E
SMART Domains Protein: ENSMUSP00000119587
Gene: ENSMUSG00000036817
AA Change: D49E

DomainStartEndE-ValueType
coiled coil region 58 126 N/A INTRINSIC
PDB:4DXS|A 207 258 1e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000135926
SMART Domains Protein: ENSMUSP00000114488
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
ZnF_C2H2 11 33 5.2e0 SMART
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 149 171 N/A INTRINSIC
low complexity region 202 211 N/A INTRINSIC
coiled coil region 227 255 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153469
Meta Mutation Damage Score 0.0776 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the unc-84 homolog family and encodes a nuclear nuclear envelope protein with an Unc84 (SUN) domain. The protein is involved in nuclear anchorage and migration. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit sterility due to arrested meiosis, hearing loss associated with outer hair cell degeneration, abnormal cerebellum development, ataxia, impaired motor coordination, and abnormal Purkinje cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 T C 2: 26,991,294 V761A probably benign Het
Arap1 G T 7: 101,400,526 A1032S possibly damaging Het
Atg4d C T 9: 21,268,445 H230Y probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bcdin3d T A 15: 99,470,680 K213* probably null Het
Cep295nl T A 11: 118,333,028 E330V probably benign Het
Col10a1 A G 10: 34,395,718 Y562C probably damaging Het
Col9a2 G A 4: 121,053,902 R578Q probably damaging Het
Creld1 A G 6: 113,484,574 D85G possibly damaging Het
Cth A T 3: 157,913,727 V153D probably damaging Het
Dazap2 T A 15: 100,618,003 Y71N probably damaging Het
Ddah1 A C 3: 145,891,506 D269A probably damaging Het
Dhx9 A C 1: 153,458,488 D975E probably benign Het
Erich3 T A 3: 154,762,327 D805E possibly damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Gabpb2 T C 3: 95,206,515 D19G probably damaging Het
Gabrr1 T A 4: 33,161,651 M325K probably damaging Het
Galntl5 T G 5: 25,220,122 N379K possibly damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm21964 C A 8: 110,110,163 T227N probably damaging Het
Gm42791 C A 5: 148,959,501 probably benign Het
Gm5356 G A 8: 89,187,056 noncoding transcript Het
Kifap3 C T 1: 163,783,097 R49* probably null Het
Kmt2c C T 5: 25,315,005 G2036R probably damaging Het
Lce1l A T 3: 92,850,419 V44E unknown Het
Lmbr1 T A 5: 29,361,083 E48D probably benign Het
Nes C A 3: 87,977,441 N958K probably benign Het
Nwd1 A C 8: 72,711,620 H1432P probably damaging Het
Olfr651 T C 7: 104,553,228 F103S probably damaging Het
Olfr715b G A 7: 107,106,202 H220Y probably benign Het
Osgepl1 A G 1: 53,317,903 T75A probably benign Het
Perm1 T C 4: 156,218,072 S358P possibly damaging Het
Pramef17 C T 4: 143,993,432 G121D probably benign Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Sdc4 G T 2: 164,431,286 Q35K probably benign Het
Secisbp2 A G 13: 51,670,846 S377G probably benign Het
Spag16 G C 1: 70,493,782 G540A probably damaging Het
Taf3 A G 2: 9,952,366 V177A probably benign Het
Thbs2 A G 17: 14,685,900 L246P possibly damaging Het
Trpm1 G T 7: 64,235,821 G862* probably null Het
Trpm8 A T 1: 88,350,856 T584S possibly damaging Het
Ythdc2 T C 18: 44,828,690 S2P probably benign Het
Zc2hc1c G T 12: 85,289,812 R81L probably benign Het
Zfp292 C A 4: 34,811,237 L602F probably damaging Het
Other mutations in Sun1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Sun1 APN 5 139234685 critical splice acceptor site probably null
IGL01364:Sun1 APN 5 139234741 missense probably damaging 1.00
IGL02142:Sun1 APN 5 139231163 missense possibly damaging 0.95
IGL02251:Sun1 APN 5 139241431 missense probably damaging 1.00
IGL02939:Sun1 APN 5 139235488 splice site probably benign
IGL03253:Sun1 APN 5 139223586 splice site probably benign
IGL03370:Sun1 APN 5 139231131 missense probably damaging 0.96
PIT4418001:Sun1 UTSW 5 139226588 missense probably damaging 0.97
R0124:Sun1 UTSW 5 139246679 unclassified probably benign
R0145:Sun1 UTSW 5 139241411 missense probably damaging 0.98
R0376:Sun1 UTSW 5 139226699 unclassified probably benign
R0512:Sun1 UTSW 5 139234847 splice site probably benign
R0729:Sun1 UTSW 5 139237864 unclassified probably benign
R0733:Sun1 UTSW 5 139231163 missense possibly damaging 0.63
R1188:Sun1 UTSW 5 139238856 missense probably damaging 0.98
R1733:Sun1 UTSW 5 139230789 missense possibly damaging 0.82
R1913:Sun1 UTSW 5 139235732 critical splice donor site probably null
R2033:Sun1 UTSW 5 139225438 missense probably damaging 1.00
R2200:Sun1 UTSW 5 139231219 missense probably benign 0.11
R3084:Sun1 UTSW 5 139235601 missense probably benign 0.41
R3085:Sun1 UTSW 5 139235601 missense probably benign 0.41
R3771:Sun1 UTSW 5 139238820 unclassified probably benign
R3772:Sun1 UTSW 5 139238820 unclassified probably benign
R3804:Sun1 UTSW 5 139225362 nonsense probably null
R4300:Sun1 UTSW 5 139227594 unclassified probably benign
R4428:Sun1 UTSW 5 139234475 intron probably benign
R4993:Sun1 UTSW 5 139225333 missense possibly damaging 0.84
R5075:Sun1 UTSW 5 139226891 splice site probably null
R5363:Sun1 UTSW 5 139234743 missense probably damaging 1.00
R5826:Sun1 UTSW 5 139245416 missense probably damaging 1.00
R6753:Sun1 UTSW 5 139215259 splice site probably null
R7218:Sun1 UTSW 5 139226687 missense unknown
R7320:Sun1 UTSW 5 139248484 missense probably damaging 1.00
R7448:Sun1 UTSW 5 139246834 missense probably damaging 1.00
R7494:Sun1 UTSW 5 139235720 missense not run
Predicted Primers PCR Primer
(F):5'- GCAGTGCCACAACCATGATGAGAG -3'
(R):5'- GGCTACAGATGAACTCGTTACCCG -3'

Sequencing Primer
(F):5'- CAACCATGATGAGAGACTTGC -3'
(R):5'- GCAATGCTTAAAGGACTTTGATGG -3'
Posted On2014-05-14