Incidental Mutation 'R1724:Creld1'
ID191673
Institutional Source Beutler Lab
Gene Symbol Creld1
Ensembl Gene ENSMUSG00000030284
Gene Namecysteine-rich with EGF-like domains 1
SynonymsAI843811
MMRRC Submission 039756-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1724 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location113483297-113493343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113484574 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 85 (D85G)
Ref Sequence ENSEMBL: ENSMUSP00000032422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032422] [ENSMUST00000058300]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032422
AA Change: D85G

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032422
Gene: ENSMUSG00000030284
AA Change: D85G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:DUF3456 45 103 1.7e-9 PFAM
EGF 154 193 2.11e1 SMART
FU 208 255 1.66e-1 SMART
EGF 213 244 2.2e1 SMART
EGF_like 245 290 4.26e-3 SMART
FU 268 315 4.46e-2 SMART
EGF_CA 305 344 1.1e-7 SMART
transmembrane domain 363 382 N/A INTRINSIC
transmembrane domain 387 406 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058300
SMART Domains Protein: ENSMUSP00000055343
Gene: ENSMUSG00000030281

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:IL17_R_N 71 190 2.8e-45 PFAM
Pfam:IL17_R_N 189 432 1.3e-93 PFAM
transmembrane domain 441 460 N/A INTRINSIC
Pfam:SEFIR 473 623 7.7e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156764
Predicted Effect probably benign
Transcript: ENSMUST00000205208
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of epidermal growth factor-related proteins. The encoded protein is characterized by a cysteine-rich with epidermal growth factor-like domain. This protein may function as a cell adhesion molecule. Mutations in this gene are the cause of atrioventricular septal defect. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygous KO is embryonic lethal: abnormal vasculature and brain and craniofacial development and reduced atrioventricular cushion size at E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 T C 2: 26,991,294 V761A probably benign Het
Arap1 G T 7: 101,400,526 A1032S possibly damaging Het
Atg4d C T 9: 21,268,445 H230Y probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bcdin3d T A 15: 99,470,680 K213* probably null Het
Cep295nl T A 11: 118,333,028 E330V probably benign Het
Col10a1 A G 10: 34,395,718 Y562C probably damaging Het
Col9a2 G A 4: 121,053,902 R578Q probably damaging Het
Cth A T 3: 157,913,727 V153D probably damaging Het
Dazap2 T A 15: 100,618,003 Y71N probably damaging Het
Ddah1 A C 3: 145,891,506 D269A probably damaging Het
Dhx9 A C 1: 153,458,488 D975E probably benign Het
Erich3 T A 3: 154,762,327 D805E possibly damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Gabpb2 T C 3: 95,206,515 D19G probably damaging Het
Gabrr1 T A 4: 33,161,651 M325K probably damaging Het
Galntl5 T G 5: 25,220,122 N379K possibly damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm21964 C A 8: 110,110,163 T227N probably damaging Het
Gm42791 C A 5: 148,959,501 probably benign Het
Gm5356 G A 8: 89,187,056 noncoding transcript Het
Kifap3 C T 1: 163,783,097 R49* probably null Het
Kmt2c C T 5: 25,315,005 G2036R probably damaging Het
Lce1l A T 3: 92,850,419 V44E unknown Het
Lmbr1 T A 5: 29,361,083 E48D probably benign Het
Nes C A 3: 87,977,441 N958K probably benign Het
Nwd1 A C 8: 72,711,620 H1432P probably damaging Het
Olfr651 T C 7: 104,553,228 F103S probably damaging Het
Olfr715b G A 7: 107,106,202 H220Y probably benign Het
Osgepl1 A G 1: 53,317,903 T75A probably benign Het
Perm1 T C 4: 156,218,072 S358P possibly damaging Het
Pramef17 C T 4: 143,993,432 G121D probably benign Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Sdc4 G T 2: 164,431,286 Q35K probably benign Het
Secisbp2 A G 13: 51,670,846 S377G probably benign Het
Spag16 G C 1: 70,493,782 G540A probably damaging Het
Sun1 T A 5: 139,235,725 D517E probably benign Het
Taf3 A G 2: 9,952,366 V177A probably benign Het
Thbs2 A G 17: 14,685,900 L246P possibly damaging Het
Trpm1 G T 7: 64,235,821 G862* probably null Het
Trpm8 A T 1: 88,350,856 T584S possibly damaging Het
Ythdc2 T C 18: 44,828,690 S2P probably benign Het
Zc2hc1c G T 12: 85,289,812 R81L probably benign Het
Zfp292 C A 4: 34,811,237 L602F probably damaging Het
Other mutations in Creld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01924:Creld1 APN 6 113483960 missense probably benign
IGL01959:Creld1 APN 6 113492833 missense probably damaging 0.99
IGL03061:Creld1 APN 6 113488097 missense probably damaging 1.00
IGL03266:Creld1 APN 6 113489597 missense probably benign 0.05
impregnable UTSW 6 113489479 missense probably damaging 1.00
R1118:Creld1 UTSW 6 113491695 missense probably benign 0.01
R1144:Creld1 UTSW 6 113483961 missense probably benign 0.37
R1192:Creld1 UTSW 6 113489479 missense probably damaging 1.00
R1517:Creld1 UTSW 6 113489784 missense probably damaging 1.00
R1882:Creld1 UTSW 6 113492205 missense probably damaging 1.00
R2411:Creld1 UTSW 6 113489776 missense probably benign 0.09
R3956:Creld1 UTSW 6 113492229 missense possibly damaging 0.68
R4757:Creld1 UTSW 6 113492247 missense probably benign 0.08
R4939:Creld1 UTSW 6 113488179 missense probably benign 0.13
R5887:Creld1 UTSW 6 113492899 makesense probably null
R6813:Creld1 UTSW 6 113489569 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGTGTCACAGTGCCTCAGTTTTC -3'
(R):5'- CCTACTGTTCAAACGGACCATCCTG -3'

Sequencing Primer
(F):5'- tggggaggcagaggcag -3'
(R):5'- TCTTCACCTGACAGGTTGTG -3'
Posted On2014-05-14