Incidental Mutation 'R1724:Col10a1'
ID191684
Institutional Source Beutler Lab
Gene Symbol Col10a1
Ensembl Gene ENSMUSG00000039462
Gene Namecollagen, type X, alpha 1
SynonymsCol10a-1, Col10
MMRRC Submission 039756-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R1724 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location34389981-34397085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34395718 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 562 (Y562C)
Ref Sequence ENSEMBL: ENSMUSP00000101150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047885] [ENSMUST00000099973] [ENSMUST00000105511] [ENSMUST00000105512] [ENSMUST00000213269]
Predicted Effect probably benign
Transcript: ENSMUST00000047885
SMART Domains Protein: ENSMUSP00000047126
Gene: ENSMUSG00000039480

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 382 2.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099973
SMART Domains Protein: ENSMUSP00000097553
Gene: ENSMUSG00000039480

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 189 8.8e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105511
AA Change: Y562C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101150
Gene: ENSMUSG00000039462
AA Change: Y562C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 60 101 N/A INTRINSIC
Pfam:Collagen 103 155 1.4e-9 PFAM
Pfam:Collagen 153 218 1.4e-8 PFAM
Pfam:Collagen 193 250 2.6e-9 PFAM
Pfam:Collagen 206 264 3.8e-8 PFAM
low complexity region 282 323 N/A INTRINSIC
internal_repeat_2 329 361 2.25e-6 PROSPERO
internal_repeat_1 331 365 5.9e-14 PROSPERO
low complexity region 368 383 N/A INTRINSIC
low complexity region 391 410 N/A INTRINSIC
Pfam:Collagen 413 483 9.3e-10 PFAM
low complexity region 487 517 N/A INTRINSIC
C1Q 545 680 2.85e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105512
SMART Domains Protein: ENSMUSP00000101151
Gene: ENSMUSG00000039480

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 372 8.7e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130290
Predicted Effect probably benign
Transcript: ENSMUST00000213269
Meta Mutation Damage Score 0.202 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type X collagen, a short chain collagen expressed by hypertrophic chondrocytes during endochondral ossification. Unlike type VIII collagen, the other short chain collagen, type X collagen is a homotrimer. Mutations in this gene are associated with Schmid type metaphyseal chondrodysplasia (SMCD) and Japanese type spondylometaphyseal dysplasia (SMD). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations may exhibit abnormal trabecular bone, thinner growth plate resting zone and articular cartilage, and altered bone content. Mice homozygous for another knock-out allele exhibit altered B and T cell populations and TH1/TH2responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 T C 2: 26,991,294 V761A probably benign Het
Arap1 G T 7: 101,400,526 A1032S possibly damaging Het
Atg4d C T 9: 21,268,445 H230Y probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bcdin3d T A 15: 99,470,680 K213* probably null Het
Cep295nl T A 11: 118,333,028 E330V probably benign Het
Col9a2 G A 4: 121,053,902 R578Q probably damaging Het
Creld1 A G 6: 113,484,574 D85G possibly damaging Het
Cth A T 3: 157,913,727 V153D probably damaging Het
Dazap2 T A 15: 100,618,003 Y71N probably damaging Het
Ddah1 A C 3: 145,891,506 D269A probably damaging Het
Dhx9 A C 1: 153,458,488 D975E probably benign Het
Erich3 T A 3: 154,762,327 D805E possibly damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Gabpb2 T C 3: 95,206,515 D19G probably damaging Het
Gabrr1 T A 4: 33,161,651 M325K probably damaging Het
Galntl5 T G 5: 25,220,122 N379K possibly damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm21964 C A 8: 110,110,163 T227N probably damaging Het
Gm42791 C A 5: 148,959,501 probably benign Het
Gm5356 G A 8: 89,187,056 noncoding transcript Het
Kifap3 C T 1: 163,783,097 R49* probably null Het
Kmt2c C T 5: 25,315,005 G2036R probably damaging Het
Lce1l A T 3: 92,850,419 V44E unknown Het
Lmbr1 T A 5: 29,361,083 E48D probably benign Het
Nes C A 3: 87,977,441 N958K probably benign Het
Nwd1 A C 8: 72,711,620 H1432P probably damaging Het
Olfr651 T C 7: 104,553,228 F103S probably damaging Het
Olfr715b G A 7: 107,106,202 H220Y probably benign Het
Osgepl1 A G 1: 53,317,903 T75A probably benign Het
Perm1 T C 4: 156,218,072 S358P possibly damaging Het
Pramef17 C T 4: 143,993,432 G121D probably benign Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Sdc4 G T 2: 164,431,286 Q35K probably benign Het
Secisbp2 A G 13: 51,670,846 S377G probably benign Het
Spag16 G C 1: 70,493,782 G540A probably damaging Het
Sun1 T A 5: 139,235,725 D517E probably benign Het
Taf3 A G 2: 9,952,366 V177A probably benign Het
Thbs2 A G 17: 14,685,900 L246P possibly damaging Het
Trpm1 G T 7: 64,235,821 G862* probably null Het
Trpm8 A T 1: 88,350,856 T584S possibly damaging Het
Ythdc2 T C 18: 44,828,690 S2P probably benign Het
Zc2hc1c G T 12: 85,289,812 R81L probably benign Het
Zfp292 C A 4: 34,811,237 L602F probably damaging Het
Other mutations in Col10a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03005:Col10a1 APN 10 34395738 missense probably damaging 1.00
IGL03028:Col10a1 APN 10 34395016 missense probably benign 0.19
R0580:Col10a1 UTSW 10 34394952 missense probably benign 0.31
R0691:Col10a1 UTSW 10 34395696 missense possibly damaging 0.94
R1187:Col10a1 UTSW 10 34394838 missense probably benign 0.13
R1597:Col10a1 UTSW 10 34395078 missense probably damaging 0.99
R1826:Col10a1 UTSW 10 34394649 missense probably damaging 1.00
R1834:Col10a1 UTSW 10 34395015 missense probably damaging 1.00
R2156:Col10a1 UTSW 10 34395700 missense probably benign 0.30
R3687:Col10a1 UTSW 10 34395498 missense probably benign 0.12
R4208:Col10a1 UTSW 10 34395543 missense probably damaging 0.99
R4929:Col10a1 UTSW 10 34395124 missense probably benign 0.00
R5411:Col10a1 UTSW 10 34394557 missense probably damaging 1.00
R5433:Col10a1 UTSW 10 34390739 intron probably benign
R5481:Col10a1 UTSW 10 34395664 missense probably benign 0.09
R6036:Col10a1 UTSW 10 34395282 missense probably benign
R6036:Col10a1 UTSW 10 34395282 missense probably benign
R6208:Col10a1 UTSW 10 34394586 missense possibly damaging 0.69
R6223:Col10a1 UTSW 10 34395187 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATAGCAACTAAGGGCCTCAATGG -3'
(R):5'- ATTGCACTCCCTGAAGCCTGATCC -3'

Sequencing Primer
(F):5'- CACAGTGGAGAACCTGGTC -3'
(R):5'- CTGAAGCCTGATCCAGGTAG -3'
Posted On2014-05-14