Incidental Mutation 'R1724:Cep295nl'
ID191687
Institutional Source Beutler Lab
Gene Symbol Cep295nl
Ensembl Gene ENSMUSG00000076433
Gene NameCEP295 N-terminal like
SynonymsDdc8, BC100451
MMRRC Submission 039756-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1724 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location118332360-118342500 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118333028 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 330 (E330V)
Ref Sequence ENSEMBL: ENSMUSP00000128122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017610] [ENSMUST00000103024] [ENSMUST00000155707] [ENSMUST00000168100]
Predicted Effect probably benign
Transcript: ENSMUST00000017610
SMART Domains Protein: ENSMUSP00000017610
Gene: ENSMUSG00000017466

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
NTR 27 203 1.05e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103024
AA Change: E330V

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000099313
Gene: ENSMUSG00000076433
AA Change: E330V

DomainStartEndE-ValueType
coiled coil region 43 72 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
low complexity region 273 282 N/A INTRINSIC
low complexity region 310 322 N/A INTRINSIC
low complexity region 451 468 N/A INTRINSIC
coiled coil region 495 524 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155707
SMART Domains Protein: ENSMUSP00000122642
Gene: ENSMUSG00000017466

DomainStartEndE-ValueType
NTR 1 126 1.48e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168100
AA Change: E330V

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000128122
Gene: ENSMUSG00000076433
AA Change: E330V

DomainStartEndE-ValueType
coiled coil region 43 72 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
low complexity region 273 282 N/A INTRINSIC
low complexity region 310 322 N/A INTRINSIC
low complexity region 451 468 N/A INTRINSIC
coiled coil region 495 524 N/A INTRINSIC
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 98% (50/51)
MGI Phenotype NO_PHENOTYPE,Homozygotes for targeted null mutations exhibit impaired activation of pro-matrix metalloproteinase-2, but appear phenotypically normal.
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 T C 2: 26,991,294 V761A probably benign Het
Arap1 G T 7: 101,400,526 A1032S possibly damaging Het
Atg4d C T 9: 21,268,445 H230Y probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bcdin3d T A 15: 99,470,680 K213* probably null Het
Col10a1 A G 10: 34,395,718 Y562C probably damaging Het
Col9a2 G A 4: 121,053,902 R578Q probably damaging Het
Creld1 A G 6: 113,484,574 D85G possibly damaging Het
Cth A T 3: 157,913,727 V153D probably damaging Het
Dazap2 T A 15: 100,618,003 Y71N probably damaging Het
Ddah1 A C 3: 145,891,506 D269A probably damaging Het
Dhx9 A C 1: 153,458,488 D975E probably benign Het
Erich3 T A 3: 154,762,327 D805E possibly damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Gabpb2 T C 3: 95,206,515 D19G probably damaging Het
Gabrr1 T A 4: 33,161,651 M325K probably damaging Het
Galntl5 T G 5: 25,220,122 N379K possibly damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm21964 C A 8: 110,110,163 T227N probably damaging Het
Gm42791 C A 5: 148,959,501 probably benign Het
Gm5356 G A 8: 89,187,056 noncoding transcript Het
Kifap3 C T 1: 163,783,097 R49* probably null Het
Kmt2c C T 5: 25,315,005 G2036R probably damaging Het
Lce1l A T 3: 92,850,419 V44E unknown Het
Lmbr1 T A 5: 29,361,083 E48D probably benign Het
Nes C A 3: 87,977,441 N958K probably benign Het
Nwd1 A C 8: 72,711,620 H1432P probably damaging Het
Olfr651 T C 7: 104,553,228 F103S probably damaging Het
Olfr715b G A 7: 107,106,202 H220Y probably benign Het
Osgepl1 A G 1: 53,317,903 T75A probably benign Het
Perm1 T C 4: 156,218,072 S358P possibly damaging Het
Pramef17 C T 4: 143,993,432 G121D probably benign Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Sdc4 G T 2: 164,431,286 Q35K probably benign Het
Secisbp2 A G 13: 51,670,846 S377G probably benign Het
Spag16 G C 1: 70,493,782 G540A probably damaging Het
Sun1 T A 5: 139,235,725 D517E probably benign Het
Taf3 A G 2: 9,952,366 V177A probably benign Het
Thbs2 A G 17: 14,685,900 L246P possibly damaging Het
Trpm1 G T 7: 64,235,821 G862* probably null Het
Trpm8 A T 1: 88,350,856 T584S possibly damaging Het
Ythdc2 T C 18: 44,828,690 S2P probably benign Het
Zc2hc1c G T 12: 85,289,812 R81L probably benign Het
Zfp292 C A 4: 34,811,237 L602F probably damaging Het
Other mutations in Cep295nl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Cep295nl APN 11 118333904 missense probably damaging 0.96
IGL02883:Cep295nl APN 11 118333909 missense probably benign 0.01
R1815:Cep295nl UTSW 11 118332648 missense probably damaging 1.00
R1999:Cep295nl UTSW 11 118333089 missense probably damaging 0.99
R2161:Cep295nl UTSW 11 118332509 missense possibly damaging 0.65
R2198:Cep295nl UTSW 11 118332593 missense probably benign 0.00
R4871:Cep295nl UTSW 11 118333824 missense probably damaging 0.98
R5348:Cep295nl UTSW 11 118333599 missense probably damaging 0.98
R5759:Cep295nl UTSW 11 118333646 missense possibly damaging 0.94
R6379:Cep295nl UTSW 11 118333730 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGGGCACAGATCCCAGTGGAATTAG -3'
(R):5'- TTGCACCTGGAACAGAGGCTCAAG -3'

Sequencing Primer
(F):5'- GTGTTCTGTCAGCTCCAAAAG -3'
(R):5'- CAGAGGCTCAAGGCAGACC -3'
Posted On2014-05-14