Incidental Mutation 'R1724:Dazap2'
ID191694
Institutional Source Beutler Lab
Gene Symbol Dazap2
Ensembl Gene ENSMUSG00000000346
Gene NameDAZ associated protein 2
SynonymsGcap28, Brbp, gt6-12, Prtb
MMRRC Submission 039756-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1724 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location100615349-100620761 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100618003 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 71 (Y71N)
Ref Sequence ENSEMBL: ENSMUSP00000000356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000356] [ENSMUST00000066068] [ENSMUST00000172334] [ENSMUST00000229307] [ENSMUST00000229965] [ENSMUST00000230280] [ENSMUST00000230517]
Predicted Effect probably damaging
Transcript: ENSMUST00000000356
AA Change: Y71N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000000356
Gene: ENSMUSG00000000346
AA Change: Y71N

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
Pfam:DAZAP2 35 168 7.1e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066068
SMART Domains Protein: ENSMUSP00000066137
Gene: ENSMUSG00000053559

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172334
SMART Domains Protein: ENSMUSP00000126870
Gene: ENSMUSG00000053559

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181034
Predicted Effect probably benign
Transcript: ENSMUST00000229307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229424
Predicted Effect probably benign
Transcript: ENSMUST00000229965
Predicted Effect probably benign
Transcript: ENSMUST00000230280
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230384
Predicted Effect probably benign
Transcript: ENSMUST00000230517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230712
Meta Mutation Damage Score 0.234 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a proline-rich protein which interacts with the deleted in azoospermia (DAZ) and the deleted in azoospermia-like gene through the DAZ-like repeats. This protein also interacts with the transforming growth factor-beta signaling molecule SARA (Smad anchor for receptor activation), eukaryotic initiation factor 4G, and an E3 ubiquitinase that regulates its stability in splicing factor containing nuclear speckles. The encoded protein may function in various biological and pathological processes including spermatogenesis, cell signaling and transcription regulation, formation of stress granules during translation arrest, RNA splicing, and pathogenesis of multiple myeloma. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion are viable, fertile and do not exhibit motor coordination or balance defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 T C 2: 26,991,294 V761A probably benign Het
Arap1 G T 7: 101,400,526 A1032S possibly damaging Het
Atg4d C T 9: 21,268,445 H230Y probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bcdin3d T A 15: 99,470,680 K213* probably null Het
Cep295nl T A 11: 118,333,028 E330V probably benign Het
Col10a1 A G 10: 34,395,718 Y562C probably damaging Het
Col9a2 G A 4: 121,053,902 R578Q probably damaging Het
Creld1 A G 6: 113,484,574 D85G possibly damaging Het
Cth A T 3: 157,913,727 V153D probably damaging Het
Ddah1 A C 3: 145,891,506 D269A probably damaging Het
Dhx9 A C 1: 153,458,488 D975E probably benign Het
Erich3 T A 3: 154,762,327 D805E possibly damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Gabpb2 T C 3: 95,206,515 D19G probably damaging Het
Gabrr1 T A 4: 33,161,651 M325K probably damaging Het
Galntl5 T G 5: 25,220,122 N379K possibly damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm21964 C A 8: 110,110,163 T227N probably damaging Het
Gm42791 C A 5: 148,959,501 probably benign Het
Gm5356 G A 8: 89,187,056 noncoding transcript Het
Kifap3 C T 1: 163,783,097 R49* probably null Het
Kmt2c C T 5: 25,315,005 G2036R probably damaging Het
Lce1l A T 3: 92,850,419 V44E unknown Het
Lmbr1 T A 5: 29,361,083 E48D probably benign Het
Nes C A 3: 87,977,441 N958K probably benign Het
Nwd1 A C 8: 72,711,620 H1432P probably damaging Het
Olfr651 T C 7: 104,553,228 F103S probably damaging Het
Olfr715b G A 7: 107,106,202 H220Y probably benign Het
Osgepl1 A G 1: 53,317,903 T75A probably benign Het
Perm1 T C 4: 156,218,072 S358P possibly damaging Het
Pramef17 C T 4: 143,993,432 G121D probably benign Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Sdc4 G T 2: 164,431,286 Q35K probably benign Het
Secisbp2 A G 13: 51,670,846 S377G probably benign Het
Spag16 G C 1: 70,493,782 G540A probably damaging Het
Sun1 T A 5: 139,235,725 D517E probably benign Het
Taf3 A G 2: 9,952,366 V177A probably benign Het
Thbs2 A G 17: 14,685,900 L246P possibly damaging Het
Trpm1 G T 7: 64,235,821 G862* probably null Het
Trpm8 A T 1: 88,350,856 T584S possibly damaging Het
Ythdc2 T C 18: 44,828,690 S2P probably benign Het
Zc2hc1c G T 12: 85,289,812 R81L probably benign Het
Zfp292 C A 4: 34,811,237 L602F probably damaging Het
Other mutations in Dazap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1521:Dazap2 UTSW 15 100618065 nonsense probably null
R4273:Dazap2 UTSW 15 100618090 missense probably damaging 1.00
R6251:Dazap2 UTSW 15 100616983 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACCAGTGTGTAATCTGCAAACACAAGAA -3'
(R):5'- GCAGTGGCACCAGCTCCAAA -3'

Sequencing Primer
(F):5'- accaaaccccatttccaaaac -3'
(R):5'- GCTCCAAATCTGGCACCTG -3'
Posted On2014-05-14