Incidental Mutation 'R1690:Actn4'
ID191712
Institutional Source Beutler Lab
Gene Symbol Actn4
Ensembl Gene ENSMUSG00000054808
Gene Nameactinin alpha 4
Synonyms
MMRRC Submission 039723-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.815) question?
Stock #R1690 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location28893248-28962340 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28911525 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 263 (S263P)
Ref Sequence ENSEMBL: ENSMUSP00000151028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068045] [ENSMUST00000127210] [ENSMUST00000140622] [ENSMUST00000148196] [ENSMUST00000217157]
Predicted Effect probably damaging
Transcript: ENSMUST00000068045
AA Change: S263P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066068
Gene: ENSMUSG00000054808
AA Change: S263P

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
CH 53 153 1.08e-24 SMART
CH 166 265 3.49e-24 SMART
SPEC 297 403 2.83e0 SMART
SPEC 417 518 3.78e-23 SMART
SPEC 532 639 8.64e-9 SMART
SPEC 653 752 3.56e0 SMART
EFh 770 798 1.92e-3 SMART
EFh 811 839 1.56e-3 SMART
efhand_Ca_insen 842 908 1.27e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127210
SMART Domains Protein: ENSMUSP00000115436
Gene: ENSMUSG00000054808

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
CH 53 153 1.08e-24 SMART
CH 166 265 1.03e-21 SMART
SPEC 297 403 2.83e0 SMART
SPEC 417 518 3.78e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000140622
AA Change: S178P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123210
Gene: ENSMUSG00000054808
AA Change: S178P

DomainStartEndE-ValueType
CH 3 68 1.09e-1 SMART
CH 81 180 3.49e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144909
Predicted Effect probably benign
Transcript: ENSMUST00000148196
SMART Domains Protein: ENSMUSP00000122268
Gene: ENSMUSG00000054808

DomainStartEndE-ValueType
CH 3 68 1.09e-1 SMART
Pfam:CH 82 133 4.5e-11 PFAM
Pfam:CAMSAP_CH 89 133 9.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150493
Predicted Effect probably damaging
Transcript: ENSMUST00000217157
AA Change: S263P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, alpha actinin isoform which is concentrated in the cytoplasm, and thought to be involved in metastatic processes. Mutations in this gene have been associated with focal and segmental glomerulosclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene die either around birth or within a few months of birth. Those who do survive after birth show poor growth and kidney abnormalities including glomerulosclerosis. This is manifested functionally as proteinuria and abnormal blood urea nitrogen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 A G 1: 165,519,925 E403G probably damaging Het
Adgrg7 A T 16: 56,795,630 V11E probably damaging Het
Arhgap35 A G 7: 16,563,281 C620R probably damaging Het
Cfap43 A G 19: 47,751,066 probably null Het
Cfap54 A G 10: 93,035,442 S639P possibly damaging Het
Csf2rb T C 15: 78,348,644 V717A probably benign Het
D17H6S53E A G 17: 35,127,212 D33G possibly damaging Het
Dpf2 C T 19: 5,905,462 R131Q probably damaging Het
Dtx3l C T 16: 35,933,268 A323T probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fgf15 A G 7: 144,899,928 S213G probably damaging Het
Fmn1 T A 2: 113,525,482 F756Y unknown Het
Gm13089 T C 4: 143,698,123 E250G probably benign Het
Hnrnpk T A 13: 58,400,354 T13S probably benign Het
Htr3b T A 9: 48,937,094 M284L possibly damaging Het
Itgal T C 7: 127,302,117 M225T possibly damaging Het
Lipi A G 16: 75,541,125 Y454H probably damaging Het
Lrit3 T C 3: 129,800,745 K61R probably damaging Het
Lta4h A G 10: 93,484,692 D583G probably benign Het
Mettl17 T A 14: 51,891,461 V396D probably damaging Het
Nlrc4 G A 17: 74,437,523 R788* probably null Het
Olfr1061 T A 2: 86,413,954 I33F probably benign Het
Pepd G A 7: 35,031,357 G278D probably damaging Het
Prkcsh T A 9: 22,010,575 D245E probably damaging Het
Prlr A T 15: 10,317,590 D84V probably damaging Het
Pth2r C T 1: 65,372,303 T333I probably benign Het
Ptk2 T A 15: 73,262,610 I547F probably damaging Het
Rab11fip2 A T 19: 59,937,300 S162T probably damaging Het
Rnf41 C A 10: 128,435,460 Q80K possibly damaging Het
Scn7a T G 2: 66,675,943 D1534A probably damaging Het
Sept12 A G 16: 4,988,514 V261A probably damaging Het
Sh2d4a T C 8: 68,294,449 S110P probably benign Het
Soat1 A T 1: 156,444,574 S114T probably benign Het
Taar8a A G 10: 24,076,915 Y139C probably damaging Het
Tcf12 A G 9: 71,870,072 probably null Het
Tmem202 T A 9: 59,519,108 R258S possibly damaging Het
Ttc39b A T 4: 83,227,177 I604N probably damaging Het
Vit A G 17: 78,624,865 D467G probably damaging Het
Zc3hc1 A G 6: 30,390,941 V21A probably damaging Het
Zfp608 T A 18: 54,987,634 I294F possibly damaging Het
Zfp825 T A 13: 74,480,662 H227L probably benign Het
Other mutations in Actn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Actn4 APN 7 28904684 missense probably damaging 1.00
IGL02127:Actn4 APN 7 28897880 missense probably benign
IGL02192:Actn4 APN 7 28898400 missense possibly damaging 0.93
IGL02862:Actn4 APN 7 28912234 splice site probably benign
IGL03339:Actn4 APN 7 28901982 missense probably damaging 1.00
R0067:Actn4 UTSW 7 28911570 missense possibly damaging 0.67
R0067:Actn4 UTSW 7 28911570 missense possibly damaging 0.67
R0243:Actn4 UTSW 7 28905398 missense probably benign 0.29
R0689:Actn4 UTSW 7 28897049 missense probably damaging 1.00
R0845:Actn4 UTSW 7 28913430 missense probably damaging 1.00
R1469:Actn4 UTSW 7 28898266 splice site probably benign
R1469:Actn4 UTSW 7 28905328 missense probably benign 0.15
R1469:Actn4 UTSW 7 28905328 missense probably benign 0.15
R1581:Actn4 UTSW 7 28898646 missense probably benign 0.04
R1962:Actn4 UTSW 7 28894622 missense probably damaging 1.00
R2113:Actn4 UTSW 7 28898124 missense probably benign 0.42
R2215:Actn4 UTSW 7 28918753 missense possibly damaging 0.88
R2429:Actn4 UTSW 7 28898071 missense probably benign 0.00
R3945:Actn4 UTSW 7 28912236 splice site probably null
R3962:Actn4 UTSW 7 28898222 unclassified probably null
R3970:Actn4 UTSW 7 28962032 missense probably benign
R4909:Actn4 UTSW 7 28898657 missense probably damaging 1.00
R4985:Actn4 UTSW 7 28918986 missense probably damaging 1.00
R5155:Actn4 UTSW 7 28962017 critical splice donor site probably null
R5201:Actn4 UTSW 7 28916255 splice site probably null
R5668:Actn4 UTSW 7 28904550 missense probably damaging 1.00
R5818:Actn4 UTSW 7 28919019 missense probably damaging 1.00
R6046:Actn4 UTSW 7 28904619 missense probably benign 0.03
R6155:Actn4 UTSW 7 28896141 missense probably damaging 1.00
R6559:Actn4 UTSW 7 28907036 missense possibly damaging 0.87
R7224:Actn4 UTSW 7 28962084 missense probably benign 0.08
R7225:Actn4 UTSW 7 28898699 missense probably damaging 1.00
R7423:Actn4 UTSW 7 28894255 missense probably damaging 0.97
Z1088:Actn4 UTSW 7 28894578 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGATAGGCAGCAATGCCCAGGAC -3'
(R):5'- AGAAAGGAAGTGGCTTCCCTCCAG -3'

Sequencing Primer
(F):5'- CAATGCCCAGGACTGAGG -3'
(R):5'- GTGTGACTGAGCACGGC -3'
Posted On2014-05-14