Incidental Mutation 'R1690:Nlrc4'
ID191743
Institutional Source Beutler Lab
Gene Symbol Nlrc4
Ensembl Gene ENSMUSG00000039193
Gene NameNLR family, CARD domain containing 4
SynonymsCard12, Ipaf, 9530011P19Rik
MMRRC Submission 039723-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R1690 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location74426295-74459108 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 74437523 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 788 (R788*)
Ref Sequence ENSEMBL: ENSMUSP00000059637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052124]
PDB Structure
Crystal structure of NLRC4 reveals its autoinhibition mechanism [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000052124
AA Change: R788*
SMART Domains Protein: ENSMUSP00000059637
Gene: ENSMUSG00000039193
AA Change: R788*

DomainStartEndE-ValueType
Pfam:CARD 1 87 1.4e-20 PFAM
Pfam:NACHT 163 314 1.3e-28 PFAM
SCOP:d1yrga_ 734 1015 3e-20 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the caspase recruitment domain-containing NLR family. Family members play essential roles in innate immune response to a wide range of pathogenic organisms, tissue damage and other cellular stresses. Mutations in this gene result in autoinflammation with infantile enterocolitis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for a null allele show lack of caspase-1 activation in macrophages infected with Legionella and Salmonella, and enhanced permissivity to Legionella replication. Homozygotes for another null allele fail to show caspase dependent cell death andIL-1beta secretion upon Salmonella infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 A G 7: 28,911,525 S263P probably damaging Het
Adcy10 A G 1: 165,519,925 E403G probably damaging Het
Adgrg7 A T 16: 56,795,630 V11E probably damaging Het
Arhgap35 A G 7: 16,563,281 C620R probably damaging Het
Cfap43 A G 19: 47,751,066 probably null Het
Cfap54 A G 10: 93,035,442 S639P possibly damaging Het
Csf2rb T C 15: 78,348,644 V717A probably benign Het
D17H6S53E A G 17: 35,127,212 D33G possibly damaging Het
Dpf2 C T 19: 5,905,462 R131Q probably damaging Het
Dtx3l C T 16: 35,933,268 A323T probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fgf15 A G 7: 144,899,928 S213G probably damaging Het
Fmn1 T A 2: 113,525,482 F756Y unknown Het
Gm13089 T C 4: 143,698,123 E250G probably benign Het
Hnrnpk T A 13: 58,400,354 T13S probably benign Het
Htr3b T A 9: 48,937,094 M284L possibly damaging Het
Itgal T C 7: 127,302,117 M225T possibly damaging Het
Lipi A G 16: 75,541,125 Y454H probably damaging Het
Lrit3 T C 3: 129,800,745 K61R probably damaging Het
Lta4h A G 10: 93,484,692 D583G probably benign Het
Mettl17 T A 14: 51,891,461 V396D probably damaging Het
Olfr1061 T A 2: 86,413,954 I33F probably benign Het
Pepd G A 7: 35,031,357 G278D probably damaging Het
Prkcsh T A 9: 22,010,575 D245E probably damaging Het
Prlr A T 15: 10,317,590 D84V probably damaging Het
Pth2r C T 1: 65,372,303 T333I probably benign Het
Ptk2 T A 15: 73,262,610 I547F probably damaging Het
Rab11fip2 A T 19: 59,937,300 S162T probably damaging Het
Rnf41 C A 10: 128,435,460 Q80K possibly damaging Het
Scn7a T G 2: 66,675,943 D1534A probably damaging Het
Sept12 A G 16: 4,988,514 V261A probably damaging Het
Sh2d4a T C 8: 68,294,449 S110P probably benign Het
Soat1 A T 1: 156,444,574 S114T probably benign Het
Taar8a A G 10: 24,076,915 Y139C probably damaging Het
Tcf12 A G 9: 71,870,072 probably null Het
Tmem202 T A 9: 59,519,108 R258S possibly damaging Het
Ttc39b A T 4: 83,227,177 I604N probably damaging Het
Vit A G 17: 78,624,865 D467G probably damaging Het
Zc3hc1 A G 6: 30,390,941 V21A probably damaging Het
Zfp608 T A 18: 54,987,634 I294F possibly damaging Het
Zfp825 T A 13: 74,480,662 H227L probably benign Het
Other mutations in Nlrc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Nlrc4 APN 17 74446534 missense probably benign 0.02
IGL00427:Nlrc4 APN 17 74447092 missense probably benign
IGL00823:Nlrc4 APN 17 74447990 missense probably benign 0.01
IGL01404:Nlrc4 APN 17 74445711 missense probably damaging 1.00
IGL02178:Nlrc4 APN 17 74446843 missense probably damaging 1.00
IGL02266:Nlrc4 APN 17 74446167 missense possibly damaging 0.72
IGL03342:Nlrc4 APN 17 74445318 missense probably damaging 1.00
inwood UTSW 17 74445630 missense probably damaging 1.00
PIT4305001:Nlrc4 UTSW 17 74446309 missense probably damaging 0.99
PIT4466001:Nlrc4 UTSW 17 74427119 missense probably benign 0.01
R0077:Nlrc4 UTSW 17 74446831 missense probably damaging 1.00
R0398:Nlrc4 UTSW 17 74445920 missense probably damaging 0.99
R0639:Nlrc4 UTSW 17 74426963 missense probably benign 0.16
R1498:Nlrc4 UTSW 17 74446413 missense probably benign 0.43
R1565:Nlrc4 UTSW 17 74441931 missense probably benign 0.00
R1624:Nlrc4 UTSW 17 74445189 missense possibly damaging 0.55
R1666:Nlrc4 UTSW 17 74445906 missense probably damaging 0.97
R1668:Nlrc4 UTSW 17 74445906 missense probably damaging 0.97
R1723:Nlrc4 UTSW 17 74441908 missense probably damaging 1.00
R1988:Nlrc4 UTSW 17 74426943 missense probably benign 0.09
R1992:Nlrc4 UTSW 17 74445633 missense probably benign 0.04
R2141:Nlrc4 UTSW 17 74447951 splice site probably benign
R2256:Nlrc4 UTSW 17 74445630 missense probably damaging 1.00
R2897:Nlrc4 UTSW 17 74448045 missense probably benign
R3117:Nlrc4 UTSW 17 74436068 missense probably benign 0.00
R3861:Nlrc4 UTSW 17 74445621 missense probably benign 0.00
R4093:Nlrc4 UTSW 17 74445958 missense probably benign 0.20
R4212:Nlrc4 UTSW 17 74447115 missense possibly damaging 0.66
R4627:Nlrc4 UTSW 17 74446628 missense probably damaging 1.00
R4859:Nlrc4 UTSW 17 74436037 missense probably damaging 0.97
R4968:Nlrc4 UTSW 17 74446941 missense probably benign 0.20
R5133:Nlrc4 UTSW 17 74446717 missense possibly damaging 0.91
R5379:Nlrc4 UTSW 17 74448083 nonsense probably null
R6045:Nlrc4 UTSW 17 74446959 missense probably damaging 0.98
R6654:Nlrc4 UTSW 17 74445528 missense possibly damaging 0.55
R6712:Nlrc4 UTSW 17 74446836 missense probably damaging 0.96
R6976:Nlrc4 UTSW 17 74445939 missense probably damaging 1.00
R7030:Nlrc4 UTSW 17 74446006 missense probably damaging 1.00
R7153:Nlrc4 UTSW 17 74447103 missense possibly damaging 0.84
R7190:Nlrc4 UTSW 17 74445203 missense probably damaging 1.00
R7398:Nlrc4 UTSW 17 74446542 missense probably damaging 1.00
R7417:Nlrc4 UTSW 17 74446488 missense probably benign 0.18
R7468:Nlrc4 UTSW 17 74445512 missense probably benign 0.00
X0026:Nlrc4 UTSW 17 74446643 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTCAAGTGTCCCGTTATGCATTC -3'
(R):5'- GTTTAGTGCCAGCCTGGCTAAGAG -3'

Sequencing Primer
(F):5'- CCGTTATGCATTCAGAGAGC -3'
(R):5'- GCCTGGCTAAGAGCAATGC -3'
Posted On2014-05-14