Incidental Mutation 'R1691:Zp3'
ID 191773
Institutional Source Beutler Lab
Gene Symbol Zp3
Ensembl Gene ENSMUSG00000004948
Gene Name zona pellucida glycoprotein 3
Synonyms Zp-3
MMRRC Submission 039724-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.136) question?
Stock # R1691 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 136008959-136017478 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 136009135 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 50 (E50K)
Ref Sequence ENSEMBL: ENSMUSP00000005073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005073]
AlphaFold P10761
PDB Structure ZP-N domain of mammalian sperm receptor ZP3 (crystal form I) [X-RAY DIFFRACTION]
ZP-N domain of mammalian sperm receptor ZP3 (crystal form II) [X-RAY DIFFRACTION]
ZP-N domain of mammalian sperm receptor ZP3 (crystal form III) [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005073
AA Change: E50K

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000005073
Gene: ENSMUSG00000004948
AA Change: E50K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
ZP 45 304 1.22e-68 SMART
low complexity region 320 334 N/A INTRINSIC
transmembrane domain 387 409 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000131563
AA Change: E38K
SMART Domains Protein: ENSMUSP00000120447
Gene: ENSMUSG00000004948
AA Change: E38K

DomainStartEndE-ValueType
Pfam:Zona_pellucida 35 136 6.4e-16 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zona pellucida is an extracellular matrix that surrounds the oocyte and early embryo. It is composed primarily of three or four glycoproteins with various functions during fertilization and preimplantation development. The protein encoded by this gene is a structural component of the zona pellucida and functions in primary binding and induction of the sperm acrosome reaction. The nascent protein contains a N-terminal signal peptide sequence, a conserved ZP domain, a C-terminal consensus furin cleavage site, and a transmembrane domain. It is hypothesized that furin cleavage results in release of the mature protein from the plasma membrane for subsequent incorporation into the zona pellucida matrix. However, the requirement for furin cleavage in this process remains controversial based on mouse studies. A variation in the last exon of this gene has previously served as the basis for an additional ZP3 locus; however, sequence and literature review reveals that there is only one full-length ZP3 locus in the human genome. Another locus encoding a bipartite transcript designated POMZP3 contains a duplication of the last four exons of ZP3, including the above described variation, and maps closely to this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous female mutants are infertile. In these females oocytes lack a zona pellucida and cumulus-oocyte complexes are disrupted. Oocytes of heterozygous females have a thin zona, but females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T C 7: 82,148,814 (GRCm39) S283P probably damaging Het
Adck2 T A 6: 39,551,902 (GRCm39) L223* probably null Het
Ank T C 15: 27,591,030 (GRCm39) W390R probably damaging Het
Ano5 T C 7: 51,240,327 (GRCm39) Y752H probably damaging Het
Apcs T A 1: 172,722,160 (GRCm39) D62V probably damaging Het
Atad5 A G 11: 79,986,358 (GRCm39) T482A probably benign Het
Atp7b A G 8: 22,501,039 (GRCm39) Y955H possibly damaging Het
Ccdc13 A T 9: 121,654,134 (GRCm39) probably null Het
Ccdc157 G A 11: 4,099,030 (GRCm39) P159S probably benign Het
Cdhr3 C T 12: 33,132,246 (GRCm39) V126M probably damaging Het
Cdr1 T C X: 60,227,780 (GRCm39) D462G possibly damaging Het
Cisd1 A G 10: 71,180,559 (GRCm39) V9A probably benign Het
Col19a1 T C 1: 24,576,022 (GRCm39) R107G unknown Het
Col1a2 C A 6: 4,536,038 (GRCm39) H972Q unknown Het
Col3a1 T A 1: 45,387,776 (GRCm39) probably benign Het
Dbnl A G 11: 5,747,174 (GRCm39) S235G probably null Het
Dock4 T A 12: 40,775,754 (GRCm39) S566T probably benign Het
Efcab6 T C 15: 83,817,407 (GRCm39) D722G probably benign Het
Esyt1 T C 10: 128,361,403 (GRCm39) Q97R probably benign Het
Fat2 G A 11: 55,202,678 (GRCm39) T132I probably damaging Het
Fgd2 C T 17: 29,597,918 (GRCm39) Q618* probably null Het
Flnc T A 6: 29,441,213 (GRCm39) V389E probably benign Het
Garnl3 A T 2: 32,887,675 (GRCm39) Y778* probably null Het
Gpaa1 A T 15: 76,216,416 (GRCm39) Y45F probably damaging Het
Grid1 A T 14: 35,174,286 (GRCm39) I643F probably damaging Het
Gsdmc2 T C 15: 63,705,314 (GRCm39) D133G probably damaging Het
Hp T C 8: 110,302,204 (GRCm39) D248G probably benign Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Ifna13 T C 4: 88,562,291 (GRCm39) D111G probably benign Het
Il9r T A 11: 32,141,829 (GRCm39) Q309L possibly damaging Het
Insyn2a C T 7: 134,520,015 (GRCm39) A172T probably damaging Het
Ints1 A T 5: 139,754,687 (GRCm39) D617E probably damaging Het
Kcnj12 A T 11: 60,961,103 (GRCm39) N467I possibly damaging Het
Kmt2e T A 5: 23,669,847 (GRCm39) D111E probably damaging Het
Lama4 A G 10: 38,956,559 (GRCm39) K1161E probably benign Het
Lamc1 C T 1: 153,122,995 (GRCm39) D732N probably benign Het
Larp1 A G 11: 57,938,874 (GRCm39) T517A probably benign Het
Lrp12 A G 15: 39,735,661 (GRCm39) I757T probably damaging Het
Max T C 12: 77,000,046 (GRCm39) D23G possibly damaging Het
Nars1 A T 18: 64,649,485 (GRCm39) probably null Het
Nipsnap3a G A 4: 52,994,185 (GRCm39) D91N probably null Het
Nphp3 A G 9: 103,880,010 (GRCm39) T11A probably benign Het
Nr2c2 C A 6: 92,133,673 (GRCm39) T226K probably damaging Het
Nrxn1 A G 17: 90,469,717 (GRCm39) I1288T probably damaging Het
Nt5c1b C T 12: 10,425,537 (GRCm39) T360I possibly damaging Het
Ofcc1 C T 13: 40,362,305 (GRCm39) G206R probably benign Het
Or10a3b A G 7: 108,444,348 (GRCm39) Y290H possibly damaging Het
Or13a21 A T 7: 139,998,855 (GRCm39) L277Q probably damaging Het
Or4e1 A T 14: 52,701,288 (GRCm39) H59Q possibly damaging Het
Or4k37 G A 2: 111,159,198 (GRCm39) V145I probably benign Het
Or6d14 A G 6: 116,533,538 (GRCm39) T51A probably benign Het
Or9i1b C T 19: 13,896,783 (GRCm39) T133I probably benign Het
Pcsk1 A G 13: 75,280,344 (GRCm39) D723G possibly damaging Het
Phrf1 C A 7: 140,841,787 (GRCm39) Y715* probably null Het
Pigm T C 1: 172,204,354 (GRCm39) V30A probably benign Het
Pkd1l2 A T 8: 117,783,158 (GRCm39) F721I possibly damaging Het
Pla2g15 A G 8: 106,881,581 (GRCm39) D70G possibly damaging Het
Prl7d1 A T 13: 27,893,365 (GRCm39) I182N probably damaging Het
Prss23 T C 7: 89,159,922 (GRCm39) K49R probably benign Het
Rps6 A T 4: 86,775,046 (GRCm39) D19E probably benign Het
Slco6d1 A T 1: 98,435,292 (GRCm39) H669L probably benign Het
Svil G T 18: 5,056,336 (GRCm39) C490F probably benign Het
Tom1 T C 8: 75,778,227 (GRCm39) I103T probably damaging Het
Trim10 T A 17: 37,187,791 (GRCm39) Y336N probably damaging Het
Trim43c G T 9: 88,722,752 (GRCm39) V133F probably damaging Het
Tvp23a A G 16: 10,246,551 (GRCm39) L78P possibly damaging Het
Ugt2b38 T A 5: 87,571,991 (GRCm39) I14L probably benign Het
Unc5a A C 13: 55,150,737 (GRCm39) M520L probably damaging Het
Vmn1r174 T A 7: 23,453,337 (GRCm39) M1K probably null Het
Vmn2r58 C T 7: 41,486,913 (GRCm39) G661R possibly damaging Het
Vps41 A C 13: 19,025,413 (GRCm39) D471A probably damaging Het
Zbtb14 C A 17: 69,695,497 (GRCm39) F398L probably damaging Het
Zfp462 T A 4: 55,013,489 (GRCm39) F1818L possibly damaging Het
Other mutations in Zp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02282:Zp3 APN 5 136,013,205 (GRCm39) missense possibly damaging 0.72
IGL02563:Zp3 APN 5 136,016,464 (GRCm39) critical splice donor site probably null
IGL03185:Zp3 APN 5 136,011,575 (GRCm39) missense possibly damaging 0.94
PIT4280001:Zp3 UTSW 5 136,013,318 (GRCm39) missense possibly damaging 0.56
R0646:Zp3 UTSW 5 136,013,210 (GRCm39) missense possibly damaging 0.46
R1454:Zp3 UTSW 5 136,013,042 (GRCm39) missense probably damaging 1.00
R3415:Zp3 UTSW 5 136,014,514 (GRCm39) missense probably benign 0.07
R4599:Zp3 UTSW 5 136,013,089 (GRCm39) nonsense probably null
R4987:Zp3 UTSW 5 136,016,359 (GRCm39) nonsense probably null
R5907:Zp3 UTSW 5 136,017,377 (GRCm39) missense probably benign 0.00
R6388:Zp3 UTSW 5 136,011,548 (GRCm39) missense probably benign 0.02
R6587:Zp3 UTSW 5 136,016,352 (GRCm39) missense possibly damaging 0.68
R6629:Zp3 UTSW 5 136,016,190 (GRCm39) missense probably benign 0.00
R7438:Zp3 UTSW 5 136,011,559 (GRCm39) missense probably damaging 1.00
R8050:Zp3 UTSW 5 136,011,604 (GRCm39) missense probably damaging 1.00
R8083:Zp3 UTSW 5 136,013,376 (GRCm39) missense probably damaging 1.00
R8158:Zp3 UTSW 5 136,014,418 (GRCm39) missense probably benign 0.15
R8421:Zp3 UTSW 5 136,017,331 (GRCm39) missense probably benign 0.00
R8447:Zp3 UTSW 5 136,013,244 (GRCm39) missense probably damaging 1.00
R8529:Zp3 UTSW 5 136,016,119 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGTCAGCCTCTCATTCTGAGC -3'
(R):5'- CACTCCTGAGCCACAGTGAAAGAAG -3'

Sequencing Primer
(F):5'- CTCTCATTCTGAGCCCAGC -3'
(R):5'- TCAACAGCTCCATTGCCAG -3'
Posted On 2014-05-14