Incidental Mutation 'R1692:Ppp4r3b'
ID191880
Institutional Source Beutler Lab
Gene Symbol Ppp4r3b
Ensembl Gene ENSMUSG00000020463
Gene Nameprotein phosphatase 4 regulatory subunit 3B
SynonymsSmek2
MMRRC Submission 039725-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.579) question?
Stock #R1692 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location29172890-29220797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29188123 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 157 (I157N)
Ref Sequence ENSEMBL: ENSMUSP00000099920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020755] [ENSMUST00000102856] [ENSMUST00000156280]
Predicted Effect probably benign
Transcript: ENSMUST00000020755
AA Change: I157N

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000020755
Gene: ENSMUSG00000020463
AA Change: I157N

DomainStartEndE-ValueType
SCOP:d1k5db_ 7 96 2e-24 SMART
low complexity region 116 127 N/A INTRINSIC
Pfam:SMK-1 168 359 3.6e-84 PFAM
low complexity region 511 519 N/A INTRINSIC
low complexity region 800 809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102856
AA Change: I157N

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000099920
Gene: ENSMUSG00000020463
AA Change: I157N

DomainStartEndE-ValueType
SCOP:d1k5db_ 7 96 2e-25 SMART
low complexity region 116 127 N/A INTRINSIC
Pfam:SMK-1 166 359 3.8e-87 PFAM
low complexity region 511 519 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156280
AA Change: I119N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000119241
Gene: ENSMUSG00000020463
AA Change: I119N

DomainStartEndE-ValueType
SCOP:d1k5db_ 6 58 2e-9 SMART
low complexity region 78 89 N/A INTRINSIC
Pfam:SMK-1 128 194 3e-27 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,480 H483Q possibly damaging Het
Adam12 A T 7: 133,887,944 *582R probably null Het
Agfg2 A G 5: 137,664,371 Y145H probably damaging Het
Aldh1a1 C T 19: 20,630,818 P335S probably damaging Het
Amotl1 T C 9: 14,551,722 R732G possibly damaging Het
Ankef1 A T 2: 136,550,426 I512F probably benign Het
Atg9a A T 1: 75,190,355 D17E probably benign Het
Brd8 A T 18: 34,609,833 S253R probably damaging Het
Cd79a T A 7: 24,901,456 M192K probably damaging Het
Clcn1 T G 6: 42,313,098 F822L possibly damaging Het
Dnajb12 A G 10: 59,896,377 Y346C probably damaging Het
Erbb3 A G 10: 128,571,725 I918T probably benign Het
Fam173b T C 15: 31,602,151 probably null Het
Fam58b T C 11: 78,751,331 E111G probably benign Het
Fbxw20 G T 9: 109,221,709 T377K possibly damaging Het
Fry A G 5: 150,370,227 I462V probably damaging Het
Gmip A G 8: 69,813,903 N251S probably benign Het
Gpx1 A G 9: 108,339,475 T55A possibly damaging Het
Hmcn2 T C 2: 31,450,844 V4443A possibly damaging Het
Kdm4d A T 9: 14,464,511 I17K probably benign Het
Lamc3 A G 2: 31,921,781 S927G probably null Het
Map7d1 G A 4: 126,242,308 P36S probably damaging Het
Mfsd13a C A 19: 46,372,076 H356N probably benign Het
Mtap C T 4: 89,176,914 R268C probably benign Het
Myo1a C T 10: 127,719,334 probably null Het
Myom3 T C 4: 135,775,551 L313P probably benign Het
Nrxn2 T A 19: 6,519,268 V1391E probably damaging Het
Otoa A C 7: 121,091,551 Q3P probably damaging Het
Phldb1 T C 9: 44,715,420 E576G probably damaging Het
Pigw A C 11: 84,877,066 L479R probably damaging Het
Pip5k1a A G 3: 95,063,730 I507T probably benign Het
Rrm2b G A 15: 37,927,322 R115* probably null Het
Sall1 C T 8: 89,028,400 S1317N probably benign Het
Serpinb6b T G 13: 32,974,995 F179V probably damaging Het
Slc4a8 T A 15: 100,800,573 F648I probably damaging Het
Slc5a7 T C 17: 54,281,726 T298A probably damaging Het
Slit3 T C 11: 35,659,344 L830P probably damaging Het
Smarcc1 T A 9: 110,174,004 N387K possibly damaging Het
Tanc2 C T 11: 105,857,500 T486I probably benign Het
Tdp1 C T 12: 99,955,001 P599S probably damaging Het
Tmem33 A G 5: 67,268,554 D38G probably null Het
Uvrag C T 7: 99,004,663 R247Q probably benign Het
Vars T C 17: 35,013,725 V875A probably damaging Het
Vcl A G 14: 21,024,182 E879G probably damaging Het
Vmn1r231 C T 17: 20,890,609 V15I probably benign Het
Zfp609 T C 9: 65,795,311 T20A probably damaging Het
Zfp959 T A 17: 55,898,299 H445Q probably damaging Het
Zmiz2 T A 11: 6,400,795 V515E probably damaging Het
Zmym5 G A 14: 56,804,193 T151M probably damaging Het
Zxdc C T 6: 90,378,951 Q481* probably null Het
Other mutations in Ppp4r3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Ppp4r3b APN 11 29211782 missense possibly damaging 0.64
IGL00593:Ppp4r3b APN 11 29197205 missense possibly damaging 0.88
IGL01109:Ppp4r3b APN 11 29188288 missense probably damaging 0.97
IGL01311:Ppp4r3b APN 11 29194591 missense probably benign
IGL01397:Ppp4r3b APN 11 29213594 missense probably benign 0.05
IGL01546:Ppp4r3b APN 11 29209488 unclassified probably null
IGL02588:Ppp4r3b APN 11 29198853 nonsense probably null
IGL02713:Ppp4r3b APN 11 29188445 missense probably damaging 0.98
IGL02717:Ppp4r3b APN 11 29173315 missense probably benign 0.01
PIT1430001:Ppp4r3b UTSW 11 29209434 missense probably benign 0.04
R0766:Ppp4r3b UTSW 11 29173358 missense probably benign 0.16
R1170:Ppp4r3b UTSW 11 29209426 missense probably damaging 0.99
R1312:Ppp4r3b UTSW 11 29173358 missense probably benign 0.16
R1511:Ppp4r3b UTSW 11 29182460 missense probably damaging 1.00
R1699:Ppp4r3b UTSW 11 29213765 missense possibly damaging 0.52
R2303:Ppp4r3b UTSW 11 29200741 missense possibly damaging 0.79
R2339:Ppp4r3b UTSW 11 29200725 missense possibly damaging 0.65
R4378:Ppp4r3b UTSW 11 29209450 missense possibly damaging 0.72
R4940:Ppp4r3b UTSW 11 29211740 missense probably benign
R5256:Ppp4r3b UTSW 11 29188293 missense probably benign 0.22
R5266:Ppp4r3b UTSW 11 29173309 missense possibly damaging 0.63
R5286:Ppp4r3b UTSW 11 29211667 missense probably benign
R5354:Ppp4r3b UTSW 11 29211646 missense probably benign 0.26
R5877:Ppp4r3b UTSW 11 29209356 missense probably damaging 1.00
R6364:Ppp4r3b UTSW 11 29188035 missense probably benign 0.00
R6539:Ppp4r3b UTSW 11 29218503 missense probably benign 0.00
R6773:Ppp4r3b UTSW 11 29205639 missense probably benign 0.02
R6931:Ppp4r3b UTSW 11 29211786 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGGTTCAAGGTAAGGACCCATCAGTAG -3'
(R):5'- AAAGCAGGATCATATTCAAGGCATCCC -3'

Sequencing Primer
(F):5'- TAGAAGTCACACAGGACCTCATTG -3'
(R):5'- TATTCAAGGCATCCCACGAC -3'
Posted On2014-05-14