Incidental Mutation 'R1695:Gtf3c3'
ID192087
Institutional Source Beutler Lab
Gene Symbol Gtf3c3
Ensembl Gene ENSMUSG00000041303
Gene Namegeneral transcription factor IIIC, polypeptide 3
Synonyms
MMRRC Submission 039728-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #R1695 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location54396004-54438971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 54417778 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 488 (A488T)
Ref Sequence ENSEMBL: ENSMUSP00000039420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041638]
Predicted Effect probably damaging
Transcript: ENSMUST00000041638
AA Change: A488T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039420
Gene: ENSMUSG00000041303
AA Change: A488T

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
low complexity region 92 108 N/A INTRINSIC
TPR 145 178 9.24e1 SMART
TPR 179 212 2.36e1 SMART
TPR 213 246 4.58e-4 SMART
TPR 247 280 6.4e1 SMART
Blast:TPR 286 319 6e-9 BLAST
low complexity region 353 365 N/A INTRINSIC
TPR 452 485 1.87e1 SMART
low complexity region 549 560 N/A INTRINSIC
TPR 807 840 3.27e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190419
Meta Mutation Damage Score 0.348 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the TFIIIC2 complex, which binds to the promoters of small nuclear and cytoplasmic RNA genes in order to recruit RNA polymerase III. The TFIIIC2 complex is composed of six subunits. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik T A 4: 10,874,644 D10E probably damaging Het
Adam1b T A 5: 121,500,907 T692S probably benign Het
Adgrf3 T A 5: 30,203,555 N75I probably benign Het
Adgrg5 A G 8: 94,937,745 M328V probably damaging Het
Adk A G 14: 21,381,600 D286G probably benign Het
Ankrd28 T A 14: 31,707,244 D917V probably damaging Het
Appl2 C T 10: 83,621,582 D141N probably damaging Het
Arfgef2 T C 2: 166,864,712 V952A probably damaging Het
Arpc2 T A 1: 74,248,232 H70Q probably damaging Het
Bpifa5 T C 2: 154,167,660 L261P probably damaging Het
Brca1 G T 11: 101,524,455 T951K probably damaging Het
Ccdc189 A G 7: 127,587,573 probably null Het
Ccdc73 A T 2: 104,992,105 S800C probably damaging Het
Cdh15 C G 8: 122,862,016 D276E probably benign Het
Cfh T C 1: 140,102,837 I551V probably damaging Het
Chd7 T A 4: 8,833,960 L1238Q probably damaging Het
Chd9 T G 8: 91,001,782 F1275L probably damaging Het
Chrnb3 A G 8: 27,393,700 Y155C probably damaging Het
Cltc C A 11: 86,701,060 probably null Het
Ctsll3 T A 13: 60,800,977 N55Y probably damaging Het
Cysltr2 T C 14: 73,029,881 M130V probably benign Het
Daglb T C 5: 143,494,606 M455T probably benign Het
Dbn1 A G 13: 55,476,708 S343P probably benign Het
Dnah2 T A 11: 69,514,691 D665V possibly damaging Het
Dusp6 T A 10: 99,263,693 M1K probably null Het
Eif3m T C 2: 105,016,953 E12G probably damaging Het
Epha2 T C 4: 141,306,517 V29A possibly damaging Het
Fam160b1 T C 19: 57,379,171 W337R probably damaging Het
Farp2 T A 1: 93,560,325 N91K probably damaging Het
Ferd3l C A 12: 33,928,972 S161R probably benign Het
Fgd2 A T 17: 29,368,245 D315V possibly damaging Het
Fstl4 T A 11: 53,165,878 probably null Het
Grm5 A G 7: 88,036,103 D476G possibly damaging Het
Hdlbp A G 1: 93,437,200 L115P probably damaging Het
Hk2 T A 6: 82,744,951 N136Y probably damaging Het
Hs2st1 G T 3: 144,434,654 A302E probably benign Het
Htr7 T C 19: 35,969,736 N293D probably benign Het
Ikbkb T A 8: 22,673,480 E271D probably benign Het
Il5ra A T 6: 106,738,374 Y166* probably null Het
Il9r T A 11: 32,193,227 H244L probably benign Het
Itih4 T C 14: 30,891,499 probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Large1 A T 8: 72,818,082 D689E probably damaging Het
Limk2 A G 11: 3,353,275 probably null Het
Med15 A G 16: 17,722,780 F34S probably damaging Het
Mprip C T 11: 59,752,531 T505I probably damaging Het
Mtor T A 4: 148,538,907 N2071K probably benign Het
Muc16 A G 9: 18,497,433 L2522P probably damaging Het
Myd88 A T 9: 119,337,842 probably null Het
Myo7a A C 7: 98,092,496 F484V possibly damaging Het
Nme1 A C 11: 93,960,767 L81R probably benign Het
Ntn4 T A 10: 93,733,602 probably null Het
Olfr1180 T C 2: 88,412,100 D186G probably damaging Het
Olfr1383 T C 11: 49,524,335 V204A probably benign Het
Olfr630 A T 7: 103,754,924 Y220* probably null Het
Otogl T G 10: 107,814,017 N1159T probably damaging Het
Pabpc6 G A 17: 9,668,074 T516I probably benign Het
Pcdh1 C T 18: 38,202,868 R238H probably damaging Het
Pex5l T A 3: 32,954,382 N151I probably benign Het
Plekha7 T C 7: 116,128,685 N980S probably damaging Het
Reg4 C T 3: 98,236,361 T157I probably benign Het
Rev3l G T 10: 39,824,615 E1703* probably null Het
Rev3l A T 10: 39,824,616 E1703V probably damaging Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Saal1 T C 7: 46,692,916 K368E probably damaging Het
Scn9a C T 2: 66,504,876 W1245* probably null Het
Slc38a11 T A 2: 65,316,971 L387F probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sptb C A 12: 76,620,867 V819L probably benign Het
Sptbn1 T C 11: 30,136,124 T1195A probably benign Het
Ssna1 C A 2: 25,272,012 V57F possibly damaging Het
Stk32a G T 18: 43,313,420 E312* probably null Het
Synpo A G 18: 60,603,387 F496L probably benign Het
Syt15 C T 14: 34,222,901 T135M probably benign Het
Tm9sf4 A G 2: 153,190,912 E246G probably benign Het
Trim44 T C 2: 102,357,485 M308V possibly damaging Het
Unc119b T A 5: 115,134,826 K29* probably null Het
Vim T A 2: 13,580,110 D367E probably benign Het
Virma T A 4: 11,494,814 N38K probably damaging Het
Vmn1r228 A T 17: 20,776,298 D319E possibly damaging Het
Vmn2r32 T A 7: 7,463,992 I846F probably benign Het
Vps13b T C 15: 35,576,521 V1025A probably benign Het
Vps13c G T 9: 67,972,075 E566* probably null Het
Other mutations in Gtf3c3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Gtf3c3 APN 1 54415955 missense probably damaging 0.99
IGL00435:Gtf3c3 APN 1 54427535 missense possibly damaging 0.73
IGL01128:Gtf3c3 APN 1 54428876 missense possibly damaging 0.91
R0243:Gtf3c3 UTSW 1 54403536 missense possibly damaging 0.60
R0271:Gtf3c3 UTSW 1 54428812 missense possibly damaging 0.96
R0571:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R0965:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R0968:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1069:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1070:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1111:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1112:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1113:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1114:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1115:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1117:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1118:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1119:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1228:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1230:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1231:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1313:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1313:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1382:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1394:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1395:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1397:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1414:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1430:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1432:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1473:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1497:Gtf3c3 UTSW 1 54437939 missense probably benign
R1556:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1563:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1638:Gtf3c3 UTSW 1 54405119 missense probably damaging 1.00
R1716:Gtf3c3 UTSW 1 54399260 missense probably damaging 1.00
R1745:Gtf3c3 UTSW 1 54434212 missense probably damaging 1.00
R1767:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1799:Gtf3c3 UTSW 1 54420424 missense possibly damaging 0.82
R1861:Gtf3c3 UTSW 1 54438838 missense possibly damaging 0.87
R1940:Gtf3c3 UTSW 1 54428958 splice site probably benign
R3804:Gtf3c3 UTSW 1 54424007 critical splice donor site probably null
R4496:Gtf3c3 UTSW 1 54424132 missense probably benign 0.03
R4621:Gtf3c3 UTSW 1 54419416 missense probably damaging 1.00
R5131:Gtf3c3 UTSW 1 54419498 synonymous probably null
R5320:Gtf3c3 UTSW 1 54405873 missense probably damaging 1.00
R5605:Gtf3c3 UTSW 1 54415926 missense probably benign 0.06
R5854:Gtf3c3 UTSW 1 54419437 missense probably benign 0.01
R6050:Gtf3c3 UTSW 1 54406070 missense probably benign 0.00
R6441:Gtf3c3 UTSW 1 54406038 missense probably benign 0.03
R6892:Gtf3c3 UTSW 1 54415941 missense probably benign 0.00
R7114:Gtf3c3 UTSW 1 54423507 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGATCTGCCATGCAAGCCTAAAGAC -3'
(R):5'- AGGATTGCAAATCAGTGAGGCTGTG -3'

Sequencing Primer
(F):5'- gaaggaccctgatgctcac -3'
(R):5'- TCAGTGAGGCTGTGTCATAAAG -3'
Posted On2014-05-14