Incidental Mutation 'R1695:Epha2'
ID192113
Institutional Source Beutler Lab
Gene Symbol Epha2
Ensembl Gene ENSMUSG00000006445
Gene NameEph receptor A2
SynonymsMyk2, Eck, Sek-2, Sek2
MMRRC Submission 039728-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.827) question?
Stock #R1695 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location141301240-141329384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141306517 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 29 (V29A)
Ref Sequence ENSEMBL: ENSMUSP00000006614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006614]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006614
AA Change: V29A

PolyPhen 2 Score 0.738 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000006614
Gene: ENSMUSG00000006445
AA Change: V29A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EPH_lbd 27 200 1.31e-112 SMART
FN3 330 420 1.16e-6 SMART
FN3 437 517 3.73e-10 SMART
Pfam:EphA2_TM 538 611 5.9e-22 PFAM
TyrKc 614 872 2.23e-135 SMART
SAM 902 969 1.5e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145523
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene encodes a protein that binds ephrin-A ligands. Mutations in this gene are the cause of certain genetically-related cataract disorders.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal angiogenesis. Mice homozygous for a gene trap allele exhibit increased incidence of chemically-induced tumors, increased metastatic potential, and age-related cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610301B20Rik T A 4: 10,874,644 D10E probably damaging Het
Adam1b T A 5: 121,500,907 T692S probably benign Het
Adgrf3 T A 5: 30,203,555 N75I probably benign Het
Adgrg5 A G 8: 94,937,745 M328V probably damaging Het
Adk A G 14: 21,381,600 D286G probably benign Het
Ankrd28 T A 14: 31,707,244 D917V probably damaging Het
Appl2 C T 10: 83,621,582 D141N probably damaging Het
Arfgef2 T C 2: 166,864,712 V952A probably damaging Het
Arpc2 T A 1: 74,248,232 H70Q probably damaging Het
Bpifa5 T C 2: 154,167,660 L261P probably damaging Het
Brca1 G T 11: 101,524,455 T951K probably damaging Het
Ccdc189 A G 7: 127,587,573 probably null Het
Ccdc73 A T 2: 104,992,105 S800C probably damaging Het
Cdh15 C G 8: 122,862,016 D276E probably benign Het
Cfh T C 1: 140,102,837 I551V probably damaging Het
Chd7 T A 4: 8,833,960 L1238Q probably damaging Het
Chd9 T G 8: 91,001,782 F1275L probably damaging Het
Chrnb3 A G 8: 27,393,700 Y155C probably damaging Het
Cltc C A 11: 86,701,060 probably null Het
Ctsll3 T A 13: 60,800,977 N55Y probably damaging Het
Cysltr2 T C 14: 73,029,881 M130V probably benign Het
Daglb T C 5: 143,494,606 M455T probably benign Het
Dbn1 A G 13: 55,476,708 S343P probably benign Het
Dnah2 T A 11: 69,514,691 D665V possibly damaging Het
Dusp6 T A 10: 99,263,693 M1K probably null Het
Eif3m T C 2: 105,016,953 E12G probably damaging Het
Fam160b1 T C 19: 57,379,171 W337R probably damaging Het
Farp2 T A 1: 93,560,325 N91K probably damaging Het
Ferd3l C A 12: 33,928,972 S161R probably benign Het
Fgd2 A T 17: 29,368,245 D315V possibly damaging Het
Fstl4 T A 11: 53,165,878 probably null Het
Grm5 A G 7: 88,036,103 D476G possibly damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hdlbp A G 1: 93,437,200 L115P probably damaging Het
Hk2 T A 6: 82,744,951 N136Y probably damaging Het
Hs2st1 G T 3: 144,434,654 A302E probably benign Het
Htr7 T C 19: 35,969,736 N293D probably benign Het
Ikbkb T A 8: 22,673,480 E271D probably benign Het
Il5ra A T 6: 106,738,374 Y166* probably null Het
Il9r T A 11: 32,193,227 H244L probably benign Het
Itih4 T C 14: 30,891,499 probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Large1 A T 8: 72,818,082 D689E probably damaging Het
Limk2 A G 11: 3,353,275 probably null Het
Med15 A G 16: 17,722,780 F34S probably damaging Het
Mprip C T 11: 59,752,531 T505I probably damaging Het
Mtor T A 4: 148,538,907 N2071K probably benign Het
Muc16 A G 9: 18,497,433 L2522P probably damaging Het
Myd88 A T 9: 119,337,842 probably null Het
Myo7a A C 7: 98,092,496 F484V possibly damaging Het
Nme1 A C 11: 93,960,767 L81R probably benign Het
Ntn4 T A 10: 93,733,602 probably null Het
Olfr1180 T C 2: 88,412,100 D186G probably damaging Het
Olfr1383 T C 11: 49,524,335 V204A probably benign Het
Olfr630 A T 7: 103,754,924 Y220* probably null Het
Otogl T G 10: 107,814,017 N1159T probably damaging Het
Pabpc6 G A 17: 9,668,074 T516I probably benign Het
Pcdh1 C T 18: 38,202,868 R238H probably damaging Het
Pex5l T A 3: 32,954,382 N151I probably benign Het
Plekha7 T C 7: 116,128,685 N980S probably damaging Het
Reg4 C T 3: 98,236,361 T157I probably benign Het
Rev3l G T 10: 39,824,615 E1703* probably null Het
Rev3l A T 10: 39,824,616 E1703V probably damaging Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Saal1 T C 7: 46,692,916 K368E probably damaging Het
Scn9a C T 2: 66,504,876 W1245* probably null Het
Slc38a11 T A 2: 65,316,971 L387F probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sptb C A 12: 76,620,867 V819L probably benign Het
Sptbn1 T C 11: 30,136,124 T1195A probably benign Het
Ssna1 C A 2: 25,272,012 V57F possibly damaging Het
Stk32a G T 18: 43,313,420 E312* probably null Het
Synpo A G 18: 60,603,387 F496L probably benign Het
Syt15 C T 14: 34,222,901 T135M probably benign Het
Tm9sf4 A G 2: 153,190,912 E246G probably benign Het
Trim44 T C 2: 102,357,485 M308V possibly damaging Het
Unc119b T A 5: 115,134,826 K29* probably null Het
Vim T A 2: 13,580,110 D367E probably benign Het
Virma T A 4: 11,494,814 N38K probably damaging Het
Vmn1r228 A T 17: 20,776,298 D319E possibly damaging Het
Vmn2r32 T A 7: 7,463,992 I846F probably benign Het
Vps13b T C 15: 35,576,521 V1025A probably benign Het
Vps13c G T 9: 67,972,075 E566* probably null Het
Other mutations in Epha2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02148:Epha2 APN 4 141318524 missense probably damaging 1.00
IGL02812:Epha2 APN 4 141318919 splice site probably benign
IGL03377:Epha2 APN 4 141322412 missense probably benign 0.08
R0165:Epha2 UTSW 4 141321892 critical splice donor site probably null
R0321:Epha2 UTSW 4 141308405 missense probably damaging 1.00
R1584:Epha2 UTSW 4 141322047 intron probably null
R1586:Epha2 UTSW 4 141318605 splice site probably benign
R1721:Epha2 UTSW 4 141322652 missense probably damaging 1.00
R1731:Epha2 UTSW 4 141321752 missense possibly damaging 0.81
R1813:Epha2 UTSW 4 141308546 missense possibly damaging 0.86
R1875:Epha2 UTSW 4 141308979 missense probably benign 0.02
R2226:Epha2 UTSW 4 141321237 missense probably damaging 1.00
R2314:Epha2 UTSW 4 141319014 missense probably damaging 1.00
R2342:Epha2 UTSW 4 141323531 missense probably benign 0.00
R3872:Epha2 UTSW 4 141308405 missense probably damaging 1.00
R3927:Epha2 UTSW 4 141306550 missense probably damaging 1.00
R4688:Epha2 UTSW 4 141318981 missense probably benign
R4795:Epha2 UTSW 4 141322416 splice site probably null
R4974:Epha2 UTSW 4 141321705 missense probably damaging 0.99
R5055:Epha2 UTSW 4 141309069 missense probably benign 0.09
R5123:Epha2 UTSW 4 141308865 missense possibly damaging 0.71
R5424:Epha2 UTSW 4 141318940 nonsense probably null
R5522:Epha2 UTSW 4 141308556 missense probably damaging 1.00
R5657:Epha2 UTSW 4 141323494 missense probably damaging 1.00
R5717:Epha2 UTSW 4 141322071 missense probably benign
R5864:Epha2 UTSW 4 141308427 missense probably damaging 0.98
R6151:Epha2 UTSW 4 141318480 critical splice acceptor site probably null
R6244:Epha2 UTSW 4 141316912 missense probably benign 0.00
R6288:Epha2 UTSW 4 141317033 missense probably benign 0.01
R6696:Epha2 UTSW 4 141321539 missense probably benign
R6817:Epha2 UTSW 4 141308994 missense probably damaging 0.98
R6875:Epha2 UTSW 4 141328468 missense probably damaging 1.00
R6910:Epha2 UTSW 4 141321513 missense probably damaging 1.00
R6925:Epha2 UTSW 4 141308757 missense probably benign
R7330:Epha2 UTSW 4 141308453 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTGCATGAAGTGTTTGTTCCCTTG -3'
(R):5'- GTCACCACGTTTGAAGCTTGGTTG -3'

Sequencing Primer
(F):5'- TGTGTGACAAACTGAGCCC -3'
(R):5'- CCCTCAGCCCTGAAGTTTTA -3'
Posted On2014-05-14