Incidental Mutation 'R1696:Lama5'
ID192196
Institutional Source Beutler Lab
Gene Symbol Lama5
Ensembl Gene ENSMUSG00000015647
Gene Namelaminin, alpha 5
Synonyms
MMRRC Submission 039729-MU
Accession Numbers

Ncbi RefSeq: NM_001081171.2; MGI: 105382

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1696 (G1)
Quality Score97
Status Not validated
Chromosome2
Chromosomal Location180176373-180225859 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 180202486 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 331 (H331Q)
Ref Sequence ENSEMBL: ENSMUSP00000015791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015791]
PDB Structure
LAMININ ALPHA5 CHAIN N-TERMINAL FRAGMENT [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000015791
AA Change: H331Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000015791
Gene: ENSMUSG00000015647
AA Change: H331Q

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
LamNT 44 303 1.06e-132 SMART
EGF_Lam 305 361 4.35e-6 SMART
EGF_Lam 364 431 5.78e-11 SMART
EGF_Lam 434 476 1.32e-5 SMART
EGF_Lam 500 544 8.63e-10 SMART
EGF_Lam 547 590 1.16e-10 SMART
EGF_Lam 593 635 4.63e-10 SMART
EGF_Lam 638 680 6.25e-7 SMART
EGF_Lam 683 726 3.1e-11 SMART
EGF_Lam 730 779 2.99e-4 SMART
EGF_Lam 782 831 4.66e-6 SMART
EGF_Lam 834 878 3.48e-5 SMART
low complexity region 1261 1273 N/A INTRINSIC
EGF_Lam 1443 1486 7.01e-10 SMART
EGF_like 1489 1530 3.64e-1 SMART
EGF_Lam 1533 1579 8.56e-14 SMART
EGF_Lam 1582 1630 1.86e-14 SMART
LamB 1689 1819 5.86e-61 SMART
EGF_like 1818 1862 2.74e0 SMART
EGF_Lam 1865 1912 3.32e-11 SMART
EGF_Lam 1915 1968 1.61e-9 SMART
EGF_Lam 1971 2022 6.39e-13 SMART
EGF_Lam 2025 2069 1.94e-12 SMART
EGF_Lam 2072 2116 1.35e-11 SMART
EGF_like 2103 2145 3.1e1 SMART
EGF_Lam 2119 2166 1.18e-2 SMART
Pfam:Laminin_I 2189 2453 1.7e-65 PFAM
low complexity region 2532 2548 N/A INTRINSIC
low complexity region 2557 2569 N/A INTRINSIC
low complexity region 2632 2641 N/A INTRINSIC
low complexity region 2663 2676 N/A INTRINSIC
LamG 2760 2912 3.97e-8 SMART
LamG 2966 3103 1.78e-10 SMART
LamG 3149 3274 1.11e-20 SMART
LamG 3359 3497 4.05e-23 SMART
LamG 3539 3670 3e-26 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype Strain: 3624772; 1934917
Lethality: E1-E17
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the vertebrate laminin alpha chains. Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. The protein encoded by this gene is the alpha-5 subunit of of laminin-10 (laminin-511), laminin-11 (laminin-521) and laminin-15 (laminin-523). [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit disrupted basal laminae leading to exencephaly, syndactyly, placentopathy, kidney defects, abnormal lobar septation with absence of a visceral pleural membrane, and lethality in late gestation. [provided by MGI curators]
Allele List at MGI

All alleles(49) : Targeted(5) Gene trapped(44)

Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,560,597 T25A possibly damaging Het
Abca17 T C 17: 24,267,658 Y1465C possibly damaging Het
Adgrb1 C T 15: 74,588,107 R530W probably damaging Het
Ak9 A G 10: 41,327,589 T159A possibly damaging Het
Akap13 G A 7: 75,609,592 G655S possibly damaging Het
Amer2 T A 14: 60,379,674 D439E possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arfgef2 T A 2: 166,861,638 M870K probably damaging Het
Arhgef33 T C 17: 80,349,506 F150S probably damaging Het
Arid2 A T 15: 96,370,183 T726S probably benign Het
Atf7ip2 G A 16: 10,234,331 V225I probably damaging Het
Atp12a A T 14: 56,366,088 E50V probably damaging Het
Bdkrb1 A G 12: 105,604,502 N109S probably benign Het
Cald1 A G 6: 34,745,711 E104G probably damaging Het
Capn15 A G 17: 25,964,904 V267A probably benign Het
Ccng2 A T 5: 93,273,382 K250N possibly damaging Het
Ccr10 T A 11: 101,174,384 N107Y probably benign Het
Cntn2 T C 1: 132,521,279 N664S probably damaging Het
Cyp24a1 T G 2: 170,486,043 E426D probably benign Het
Cyp26a1 A G 19: 37,701,178 S441G probably benign Het
Cyp4f14 T A 17: 32,909,171 K290M possibly damaging Het
Dcp2 T A 18: 44,400,324 L114Q probably damaging Het
Dhrs7 A G 12: 72,653,120 F246S possibly damaging Het
Dlg1 T C 16: 31,781,798 V167A probably damaging Het
Dnmt3b A T 2: 153,676,710 K598* probably null Het
Dph7 T C 2: 24,969,680 probably null Het
Ehbp1 T C 11: 22,053,441 M1103V probably damaging Het
Ell2 T C 13: 75,769,558 S536P probably damaging Het
Ero1l A T 14: 45,299,935 V178E probably damaging Het
Faf2 T A 13: 54,638,254 *50R probably null Het
Fbxl14 A T 6: 119,480,146 N96I probably damaging Het
Fcrls T C 3: 87,259,518 Y56C possibly damaging Het
Foxc1 T A 13: 31,808,799 M531K unknown Het
Foxp1 A C 6: 98,945,702 S391A probably benign Het
Frem2 A T 3: 53,656,042 L348* probably null Het
Fsd1 T A 17: 55,988,257 probably null Het
Gab2 A G 7: 97,223,633 E81G probably damaging Het
Gcat G A 15: 79,035,795 V196M probably damaging Het
Gfy T C 7: 45,178,046 T209A possibly damaging Het
Ggt7 T C 2: 155,494,979 N531S possibly damaging Het
Gnai3 A G 3: 108,109,459 I343T probably damaging Het
H2-DMa A T 17: 34,138,413 Q220L probably benign Het
Heatr1 A G 13: 12,423,721 I1346V possibly damaging Het
Igfbp1 T C 11: 7,201,922 W242R probably damaging Het
Igfbp1 T A 11: 7,197,978 V7D probably benign Het
Kbtbd2 T G 6: 56,779,341 K470T probably benign Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Klhl25 G T 7: 75,866,843 G499V probably damaging Het
Krt7 A T 15: 101,423,426 T375S probably benign Het
Krt73 G A 15: 101,799,909 L238F probably damaging Het
Leng8 T G 7: 4,145,136 F663V probably damaging Het
Lrp12 G T 15: 39,878,361 H338Q probably damaging Het
Lrp6 T A 6: 134,468,723 R1042S probably damaging Het
Map6 T A 7: 99,317,457 probably null Het
Mdn1 T C 4: 32,700,417 F1459L possibly damaging Het
Mmp1b T C 9: 7,386,699 T142A probably damaging Het
Mmp23 T A 4: 155,650,709 *392C probably null Het
Nlrp4a C T 7: 26,450,534 S522F probably damaging Het
Nup93 T G 8: 94,296,555 F254V probably benign Het
Oas1h G T 5: 120,862,822 probably null Het
Ocstamp A G 2: 165,396,174 L390P probably damaging Het
Olfm1 C A 2: 28,208,116 Y20* probably null Het
Olfr1111 A G 2: 87,150,380 F94L probably benign Het
Olfr455 C T 6: 42,538,603 V140M probably benign Het
Olfr541 A T 7: 140,704,496 K82* probably null Het
Olfr608 T C 7: 103,470,177 V46A probably benign Het
Olfr853 A G 9: 19,537,894 F12S probably damaging Het
Pgghg T C 7: 140,945,311 V410A possibly damaging Het
Polr2b T A 5: 77,342,648 D878E probably benign Het
Pspc1 T C 14: 56,764,243 T225A probably benign Het
Rad21l A T 2: 151,668,527 Y3N probably damaging Het
Rbl2 A G 8: 91,085,724 N280S probably benign Het
Rdm1 C A 11: 101,630,868 Q150K probably benign Het
Rrp12 A T 19: 41,873,749 F932I probably damaging Het
Ryr2 A T 13: 11,731,657 M2003K probably benign Het
Scfd2 T C 5: 74,530,878 T248A probably benign Het
Slc22a16 G A 10: 40,584,927 A242T possibly damaging Het
Slit3 C A 11: 35,675,923 N1007K probably damaging Het
Sntg2 C A 12: 30,267,063 G187C probably damaging Het
Spag5 T C 11: 78,321,326 V1060A probably damaging Het
Spg7 G A 8: 123,090,225 V552I probably benign Het
Spns2 T A 11: 72,456,347 T434S probably benign Het
Srpk2 C T 5: 23,548,494 W87* probably null Het
St3gal3 T C 4: 117,940,392 I268V possibly damaging Het
Stat6 T C 10: 127,653,049 C356R probably damaging Het
Stx8 A G 11: 68,011,422 Q144R probably damaging Het
Tcn2 C A 11: 3,922,169 L319F probably damaging Het
Tex14 T C 11: 87,511,545 I486T possibly damaging Het
Thtpa T C 14: 55,095,785 V109A probably benign Het
Tmem127 C A 2: 127,248,707 L48I probably damaging Het
Tnfaip8 A T 18: 50,090,223 K9* probably null Het
Tnfrsf1b T A 4: 145,227,474 T102S probably benign Het
Tor1aip1 A T 1: 156,017,516 M110K possibly damaging Het
Trim10 A T 17: 36,877,181 K430* probably null Het
Trove2 T A 1: 143,757,837 I508F probably damaging Het
Trpv6 A G 6: 41,621,768 V641A possibly damaging Het
Ttf1 T G 2: 29,070,002 Y541D probably damaging Het
Ttn A G 2: 76,764,406 V20432A probably damaging Het
Vac14 A T 8: 110,632,447 probably null Het
Vipr2 G T 12: 116,139,157 A296S probably benign Het
Vmn1r1 T C 1: 182,158,059 R14G probably benign Het
Vmn1r178 T A 7: 23,894,200 N151K probably damaging Het
Vmn1r58 T A 7: 5,410,728 I168F possibly damaging Het
Vmn1r77 C T 7: 12,041,620 Q40* probably null Het
Vmn2r76 T C 7: 86,231,256 N74S possibly damaging Het
Zc2hc1c T A 12: 85,290,781 M404K possibly damaging Het
Other mutations in Lama5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Lama5 APN 2 180176543 unclassified probably benign
IGL01370:Lama5 APN 2 180197400 missense possibly damaging 0.87
IGL01474:Lama5 APN 2 180196570 missense probably damaging 1.00
IGL01614:Lama5 APN 2 180180864 missense probably damaging 1.00
IGL01941:Lama5 APN 2 180192392 missense possibly damaging 0.71
IGL01953:Lama5 APN 2 180190704 missense probably damaging 0.97
IGL02093:Lama5 APN 2 180188587 missense probably damaging 1.00
IGL02197:Lama5 APN 2 180207219 missense possibly damaging 0.82
IGL02308:Lama5 APN 2 180190327 splice site probably benign
IGL02314:Lama5 APN 2 180194482 splice site probably benign
IGL02317:Lama5 APN 2 180191319 missense probably damaging 1.00
IGL02354:Lama5 APN 2 180193884 nonsense probably null
IGL02361:Lama5 APN 2 180193884 nonsense probably null
IGL02557:Lama5 APN 2 180190932 nonsense probably null
IGL03026:Lama5 APN 2 180195967 missense probably benign 0.34
IGL03160:Lama5 APN 2 180180335 missense probably damaging 1.00
IGL03238:Lama5 APN 2 180188574 missense probably benign
IGL03390:Lama5 APN 2 180207218 missense probably damaging 1.00
Salty UTSW 2 180181651 missense possibly damaging 0.84
PIT4378001:Lama5 UTSW 2 180189445 missense possibly damaging 0.89
R0003:Lama5 UTSW 2 180178079 unclassified probably null
R0056:Lama5 UTSW 2 180187106 intron probably benign
R0147:Lama5 UTSW 2 180190406 missense probably benign
R0148:Lama5 UTSW 2 180190406 missense probably benign
R0310:Lama5 UTSW 2 180181566 splice site probably benign
R0326:Lama5 UTSW 2 180182426 missense possibly damaging 0.90
R0368:Lama5 UTSW 2 180181230 nonsense probably null
R0479:Lama5 UTSW 2 180184457 missense probably benign 0.03
R0490:Lama5 UTSW 2 180180169 missense possibly damaging 0.90
R0636:Lama5 UTSW 2 180189331 critical splice donor site probably null
R0704:Lama5 UTSW 2 180179484 missense possibly damaging 0.84
R0733:Lama5 UTSW 2 180180718 missense possibly damaging 0.83
R1017:Lama5 UTSW 2 180195420 missense probably damaging 1.00
R1078:Lama5 UTSW 2 180179764 unclassified probably benign
R1294:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1423:Lama5 UTSW 2 180195641 missense probably damaging 1.00
R1438:Lama5 UTSW 2 180182800 missense probably benign 0.01
R1447:Lama5 UTSW 2 180185878 missense probably damaging 0.99
R1540:Lama5 UTSW 2 180180151 missense probably benign
R1601:Lama5 UTSW 2 180197745 missense probably damaging 1.00
R1624:Lama5 UTSW 2 180206758 missense probably benign 0.02
R1674:Lama5 UTSW 2 180201987 missense probably benign 0.00
R1687:Lama5 UTSW 2 180194066 missense probably benign 0.00
R1701:Lama5 UTSW 2 180221369 missense probably damaging 1.00
R1778:Lama5 UTSW 2 180195481 splice site probably benign
R1936:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1939:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1940:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1953:Lama5 UTSW 2 180190747 missense possibly damaging 0.94
R1966:Lama5 UTSW 2 180188352 missense probably damaging 1.00
R2024:Lama5 UTSW 2 180179130 missense probably benign 0.00
R2079:Lama5 UTSW 2 180225508 missense possibly damaging 0.68
R2115:Lama5 UTSW 2 180186885 missense probably damaging 1.00
R2173:Lama5 UTSW 2 180196242 missense probably benign 0.00
R2272:Lama5 UTSW 2 180178603 missense possibly damaging 0.93
R2357:Lama5 UTSW 2 180180097 missense probably benign 0.01
R2860:Lama5 UTSW 2 180187247 missense probably benign 0.00
R2861:Lama5 UTSW 2 180187247 missense probably benign 0.00
R2939:Lama5 UTSW 2 180198954 missense probably damaging 1.00
R3053:Lama5 UTSW 2 180183067 missense probably damaging 0.99
R3430:Lama5 UTSW 2 180196317 missense probably benign 0.00
R3752:Lama5 UTSW 2 180187222 missense probably damaging 1.00
R3782:Lama5 UTSW 2 180194563 missense possibly damaging 0.57
R3901:Lama5 UTSW 2 180182351 splice site probably benign
R4248:Lama5 UTSW 2 180180427 missense possibly damaging 0.84
R4626:Lama5 UTSW 2 180184460 missense probably damaging 0.98
R4638:Lama5 UTSW 2 180190413 missense possibly damaging 0.89
R4669:Lama5 UTSW 2 180180637 missense probably damaging 1.00
R4673:Lama5 UTSW 2 180199266 missense probably damaging 1.00
R4677:Lama5 UTSW 2 180179366 missense possibly damaging 0.69
R4701:Lama5 UTSW 2 180191696 missense probably damaging 1.00
R4774:Lama5 UTSW 2 180185941 missense probably damaging 1.00
R4880:Lama5 UTSW 2 180177068 unclassified probably benign
R4923:Lama5 UTSW 2 180184149 missense probably benign 0.18
R4960:Lama5 UTSW 2 180208252 critical splice donor site probably null
R4983:Lama5 UTSW 2 180193449 missense probably benign 0.13
R5061:Lama5 UTSW 2 180198786 nonsense probably null
R5080:Lama5 UTSW 2 180207200 nonsense probably null
R5135:Lama5 UTSW 2 180202220 missense possibly damaging 0.89
R5206:Lama5 UTSW 2 180191304 missense probably damaging 1.00
R5296:Lama5 UTSW 2 180193801 missense probably damaging 1.00
R5319:Lama5 UTSW 2 180181118 missense probably damaging 1.00
R5355:Lama5 UTSW 2 180181651 missense possibly damaging 0.84
R5388:Lama5 UTSW 2 180190746 missense possibly damaging 0.83
R5528:Lama5 UTSW 2 180194563 missense probably benign 0.21
R5536:Lama5 UTSW 2 180189349 missense probably damaging 0.99
R5658:Lama5 UTSW 2 180208276 nonsense probably null
R5823:Lama5 UTSW 2 180192492 missense probably benign 0.04
R5885:Lama5 UTSW 2 180201831 missense probably damaging 1.00
R5889:Lama5 UTSW 2 180193674 intron probably benign
R5912:Lama5 UTSW 2 180195475 missense probably damaging 1.00
R5955:Lama5 UTSW 2 180197474 missense probably damaging 1.00
R6015:Lama5 UTSW 2 180185392 missense probably benign 0.36
R6037:Lama5 UTSW 2 180207013 missense probably damaging 1.00
R6037:Lama5 UTSW 2 180207013 missense probably damaging 1.00
R6191:Lama5 UTSW 2 180180611 missense probably damaging 0.98
R6191:Lama5 UTSW 2 180185959 missense probably damaging 1.00
R6359:Lama5 UTSW 2 180195982 missense probably benign 0.01
R6385:Lama5 UTSW 2 180196533 missense probably damaging 1.00
R6406:Lama5 UTSW 2 180197464 nonsense probably null
R6552:Lama5 UTSW 2 180181154 missense probably damaging 0.98
R6632:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6633:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6645:Lama5 UTSW 2 180179670 missense probably damaging 1.00
R6731:Lama5 UTSW 2 180188574 missense probably benign 0.09
R6744:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6798:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6799:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6801:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6851:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6869:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6881:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6882:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6884:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R7022:Lama5 UTSW 2 180180731 missense probably damaging 1.00
R7204:Lama5 UTSW 2 180202177 missense probably damaging 1.00
R7207:Lama5 UTSW 2 180207084 missense probably damaging 0.98
R7282:Lama5 UTSW 2 180201795 missense probably damaging 1.00
X0065:Lama5 UTSW 2 180181731 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TCCACCTCAGGGTCGTAGTAACAG -3'
(R):5'- CAAGCCATGTGCAGAGCCATTG -3'

Sequencing Primer
(F):5'- GTCGTAGTAACAGTCGTAGGC -3'
(R):5'- TTGCGATGGGAACTGGAAGTC -3'
Posted On2014-05-14