Incidental Mutation 'R1696:Frem2'
ID192197
Institutional Source Beutler Lab
Gene Symbol Frem2
Ensembl Gene ENSMUSG00000037016
Gene NameFras1 related extracellular matrix protein 2
Synonymsmy, ne, 6030440P17Rik, b2b1562Clo, 8430406N05Rik
MMRRC Submission 039729-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1696 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location53513938-53657355 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 53656042 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 348 (L348*)
Ref Sequence ENSEMBL: ENSMUSP00000088670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091137]
Predicted Effect probably null
Transcript: ENSMUST00000091137
AA Change: L348*
SMART Domains Protein: ENSMUSP00000088670
Gene: ENSMUSG00000037016
AA Change: L348*

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Cadherin_3 249 388 4.3e-9 PFAM
Pfam:Cadherin_3 376 532 3e-34 PFAM
Pfam:Cadherin_3 516 665 7.5e-24 PFAM
Pfam:Cadherin_3 632 798 1.6e-21 PFAM
Pfam:Cadherin_3 763 910 1.2e-25 PFAM
Pfam:Cadherin_3 879 1027 5.1e-18 PFAM
Pfam:Cadherin_3 1015 1159 2.2e-20 PFAM
CA 1202 1293 4.8e-1 SMART
Pfam:Cadherin_3 1392 1503 9.8e-24 PFAM
Pfam:Cadherin_3 1504 1612 6.2e-28 PFAM
Pfam:Cadherin_3 1613 1743 5.3e-20 PFAM
Calx_beta 1748 1847 1.5e-5 SMART
Calx_beta 1860 1971 9.47e-12 SMART
Calx_beta 1985 2092 1.65e-11 SMART
Calx_beta 2105 2209 1.99e-5 SMART
Calx_beta 2227 2331 6.9e-14 SMART
transmembrane domain 3103 3125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199323
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The encoded protein localizes to the basement membrane, forming a ternary complex that plays a role in epidermal-dermal interactions. This protein is important for the integrity of skin and renal epithelia. Mutations in this gene are associated with Fraser syndrome. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for mutations at this locus display a significant amount of embryonic lethality due to hemorrhaging of embryonic blisters. Kidney development is severely affected and syndactyly is common. Phenotypes of homozygous mutants are indistinguishable from those of Fras1 homozygous mutant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,560,597 T25A possibly damaging Het
Abca17 T C 17: 24,267,658 Y1465C possibly damaging Het
Adgrb1 C T 15: 74,588,107 R530W probably damaging Het
Ak9 A G 10: 41,327,589 T159A possibly damaging Het
Akap13 G A 7: 75,609,592 G655S possibly damaging Het
Amer2 T A 14: 60,379,674 D439E possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arfgef2 T A 2: 166,861,638 M870K probably damaging Het
Arhgef33 T C 17: 80,349,506 F150S probably damaging Het
Arid2 A T 15: 96,370,183 T726S probably benign Het
Atf7ip2 G A 16: 10,234,331 V225I probably damaging Het
Atp12a A T 14: 56,366,088 E50V probably damaging Het
Bdkrb1 A G 12: 105,604,502 N109S probably benign Het
Cald1 A G 6: 34,745,711 E104G probably damaging Het
Capn15 A G 17: 25,964,904 V267A probably benign Het
Ccng2 A T 5: 93,273,382 K250N possibly damaging Het
Ccr10 T A 11: 101,174,384 N107Y probably benign Het
Cntn2 T C 1: 132,521,279 N664S probably damaging Het
Cyp24a1 T G 2: 170,486,043 E426D probably benign Het
Cyp26a1 A G 19: 37,701,178 S441G probably benign Het
Cyp4f14 T A 17: 32,909,171 K290M possibly damaging Het
Dcp2 T A 18: 44,400,324 L114Q probably damaging Het
Dhrs7 A G 12: 72,653,120 F246S possibly damaging Het
Dlg1 T C 16: 31,781,798 V167A probably damaging Het
Dnmt3b A T 2: 153,676,710 K598* probably null Het
Dph7 T C 2: 24,969,680 probably null Het
Ehbp1 T C 11: 22,053,441 M1103V probably damaging Het
Ell2 T C 13: 75,769,558 S536P probably damaging Het
Ero1l A T 14: 45,299,935 V178E probably damaging Het
Faf2 T A 13: 54,638,254 *50R probably null Het
Fbxl14 A T 6: 119,480,146 N96I probably damaging Het
Fcrls T C 3: 87,259,518 Y56C possibly damaging Het
Foxc1 T A 13: 31,808,799 M531K unknown Het
Foxp1 A C 6: 98,945,702 S391A probably benign Het
Fsd1 T A 17: 55,988,257 probably null Het
Gab2 A G 7: 97,223,633 E81G probably damaging Het
Gcat G A 15: 79,035,795 V196M probably damaging Het
Gfy T C 7: 45,178,046 T209A possibly damaging Het
Ggt7 T C 2: 155,494,979 N531S possibly damaging Het
Gnai3 A G 3: 108,109,459 I343T probably damaging Het
H2-DMa A T 17: 34,138,413 Q220L probably benign Het
Heatr1 A G 13: 12,423,721 I1346V possibly damaging Het
Igfbp1 T A 11: 7,197,978 V7D probably benign Het
Igfbp1 T C 11: 7,201,922 W242R probably damaging Het
Kbtbd2 T G 6: 56,779,341 K470T probably benign Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Klhl25 G T 7: 75,866,843 G499V probably damaging Het
Krt7 A T 15: 101,423,426 T375S probably benign Het
Krt73 G A 15: 101,799,909 L238F probably damaging Het
Lama5 G T 2: 180,202,486 H331Q probably damaging Het
Leng8 T G 7: 4,145,136 F663V probably damaging Het
Lrp12 G T 15: 39,878,361 H338Q probably damaging Het
Lrp6 T A 6: 134,468,723 R1042S probably damaging Het
Map6 T A 7: 99,317,457 probably null Het
Mdn1 T C 4: 32,700,417 F1459L possibly damaging Het
Mmp1b T C 9: 7,386,699 T142A probably damaging Het
Mmp23 T A 4: 155,650,709 *392C probably null Het
Nlrp4a C T 7: 26,450,534 S522F probably damaging Het
Nup93 T G 8: 94,296,555 F254V probably benign Het
Oas1h G T 5: 120,862,822 probably null Het
Ocstamp A G 2: 165,396,174 L390P probably damaging Het
Olfm1 C A 2: 28,208,116 Y20* probably null Het
Olfr1111 A G 2: 87,150,380 F94L probably benign Het
Olfr455 C T 6: 42,538,603 V140M probably benign Het
Olfr541 A T 7: 140,704,496 K82* probably null Het
Olfr608 T C 7: 103,470,177 V46A probably benign Het
Olfr853 A G 9: 19,537,894 F12S probably damaging Het
Pgghg T C 7: 140,945,311 V410A possibly damaging Het
Polr2b T A 5: 77,342,648 D878E probably benign Het
Pspc1 T C 14: 56,764,243 T225A probably benign Het
Rad21l A T 2: 151,668,527 Y3N probably damaging Het
Rbl2 A G 8: 91,085,724 N280S probably benign Het
Rdm1 C A 11: 101,630,868 Q150K probably benign Het
Rrp12 A T 19: 41,873,749 F932I probably damaging Het
Ryr2 A T 13: 11,731,657 M2003K probably benign Het
Scfd2 T C 5: 74,530,878 T248A probably benign Het
Slc22a16 G A 10: 40,584,927 A242T possibly damaging Het
Slit3 C A 11: 35,675,923 N1007K probably damaging Het
Sntg2 C A 12: 30,267,063 G187C probably damaging Het
Spag5 T C 11: 78,321,326 V1060A probably damaging Het
Spg7 G A 8: 123,090,225 V552I probably benign Het
Spns2 T A 11: 72,456,347 T434S probably benign Het
Srpk2 C T 5: 23,548,494 W87* probably null Het
St3gal3 T C 4: 117,940,392 I268V possibly damaging Het
Stat6 T C 10: 127,653,049 C356R probably damaging Het
Stx8 A G 11: 68,011,422 Q144R probably damaging Het
Tcn2 C A 11: 3,922,169 L319F probably damaging Het
Tex14 T C 11: 87,511,545 I486T possibly damaging Het
Thtpa T C 14: 55,095,785 V109A probably benign Het
Tmem127 C A 2: 127,248,707 L48I probably damaging Het
Tnfaip8 A T 18: 50,090,223 K9* probably null Het
Tnfrsf1b T A 4: 145,227,474 T102S probably benign Het
Tor1aip1 A T 1: 156,017,516 M110K possibly damaging Het
Trim10 A T 17: 36,877,181 K430* probably null Het
Trove2 T A 1: 143,757,837 I508F probably damaging Het
Trpv6 A G 6: 41,621,768 V641A possibly damaging Het
Ttf1 T G 2: 29,070,002 Y541D probably damaging Het
Ttn A G 2: 76,764,406 V20432A probably damaging Het
Vac14 A T 8: 110,632,447 probably null Het
Vipr2 G T 12: 116,139,157 A296S probably benign Het
Vmn1r1 T C 1: 182,158,059 R14G probably benign Het
Vmn1r178 T A 7: 23,894,200 N151K probably damaging Het
Vmn1r58 T A 7: 5,410,728 I168F possibly damaging Het
Vmn1r77 C T 7: 12,041,620 Q40* probably null Het
Vmn2r76 T C 7: 86,231,256 N74S possibly damaging Het
Zc2hc1c T A 12: 85,290,781 M404K possibly damaging Het
Other mutations in Frem2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Frem2 APN 3 53585595 missense probably damaging 1.00
IGL00911:Frem2 APN 3 53572462 missense probably damaging 1.00
IGL01322:Frem2 APN 3 53541038 missense probably benign 0.00
IGL01330:Frem2 APN 3 53655241 missense possibly damaging 0.70
IGL01406:Frem2 APN 3 53525896 missense probably damaging 1.00
IGL01556:Frem2 APN 3 53535281 missense probably benign 0.23
IGL01580:Frem2 APN 3 53655175 missense probably damaging 1.00
IGL01606:Frem2 APN 3 53653591 missense possibly damaging 0.69
IGL01611:Frem2 APN 3 53655709 missense probably benign 0.00
IGL01648:Frem2 APN 3 53535732 missense possibly damaging 0.86
IGL01663:Frem2 APN 3 53517013 missense probably damaging 1.00
IGL01665:Frem2 APN 3 53549662 missense probably benign 0.07
IGL01670:Frem2 APN 3 53656937 missense possibly damaging 0.95
IGL01960:Frem2 APN 3 53522304 missense probably benign 0.33
IGL02175:Frem2 APN 3 53655599 missense possibly damaging 0.69
IGL02201:Frem2 APN 3 53519640 missense probably benign 0.35
IGL02202:Frem2 APN 3 53654799 missense probably benign 0.00
IGL02427:Frem2 APN 3 53535763 missense probably damaging 0.97
IGL02457:Frem2 APN 3 53521049 missense probably damaging 0.99
IGL02638:Frem2 APN 3 53551346 missense possibly damaging 0.94
IGL02801:Frem2 APN 3 53652175 missense possibly damaging 0.85
IGL03023:Frem2 APN 3 53655628 missense probably benign 0.40
IGL03169:Frem2 APN 3 53522292 missense probably benign 0.01
IGL03238:Frem2 APN 3 53656261 missense possibly damaging 0.93
IGL03251:Frem2 APN 3 53572308 missense probably benign 0.01
IGL03273:Frem2 APN 3 53537509 nonsense probably null
IGL03343:Frem2 APN 3 53652253 missense probably damaging 1.00
Biosimilar UTSW 3 53654323 missense probably benign 0.01
Fruit_stripe UTSW 3 53537489 missense probably benign 0.21
PIT4366001:Frem2 UTSW 3 53653201 missense probably damaging 0.98
R0019:Frem2 UTSW 3 53523678 missense probably damaging 0.99
R0092:Frem2 UTSW 3 53589796 missense probably benign 0.03
R0108:Frem2 UTSW 3 53647961 missense probably benign 0.03
R0115:Frem2 UTSW 3 53656208 missense probably damaging 0.99
R0118:Frem2 UTSW 3 53535243 nonsense probably null
R0374:Frem2 UTSW 3 53653960 missense probably damaging 1.00
R0437:Frem2 UTSW 3 53653015 missense possibly damaging 0.96
R0531:Frem2 UTSW 3 53519954 missense probably damaging 1.00
R0555:Frem2 UTSW 3 53516860 missense probably damaging 0.97
R0564:Frem2 UTSW 3 53656109 missense probably damaging 0.97
R0586:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R0726:Frem2 UTSW 3 53519626 missense possibly damaging 0.89
R0925:Frem2 UTSW 3 53653973 missense probably benign
R1233:Frem2 UTSW 3 53547778 missense probably damaging 0.98
R1302:Frem2 UTSW 3 53655538 missense probably benign 0.00
R1333:Frem2 UTSW 3 53549731 missense probably benign 0.26
R1446:Frem2 UTSW 3 53654596 missense probably benign 0.31
R1523:Frem2 UTSW 3 53655407 missense possibly damaging 0.73
R1539:Frem2 UTSW 3 53654210 missense probably benign 0.19
R1543:Frem2 UTSW 3 53572455 missense possibly damaging 0.86
R1597:Frem2 UTSW 3 53654519 missense probably benign 0.19
R1600:Frem2 UTSW 3 53547723 missense probably damaging 1.00
R1678:Frem2 UTSW 3 53519938 missense probably damaging 1.00
R1687:Frem2 UTSW 3 53653952 missense probably benign
R1758:Frem2 UTSW 3 53653357 missense probably damaging 1.00
R1857:Frem2 UTSW 3 53654873 missense probably benign 0.10
R1869:Frem2 UTSW 3 53535196 missense probably benign 0.04
R1921:Frem2 UTSW 3 53653495 missense possibly damaging 0.76
R1973:Frem2 UTSW 3 53652232 missense probably benign 0.01
R2045:Frem2 UTSW 3 53535744 missense probably damaging 1.00
R2113:Frem2 UTSW 3 53652922 missense probably damaging 1.00
R2152:Frem2 UTSW 3 53517029 nonsense probably null
R2164:Frem2 UTSW 3 53537330 missense probably damaging 1.00
R2181:Frem2 UTSW 3 53574587 missense possibly damaging 0.72
R2201:Frem2 UTSW 3 53516573 missense probably benign
R2221:Frem2 UTSW 3 53516857 missense probably benign 0.00
R2255:Frem2 UTSW 3 53652514 missense probably damaging 0.96
R2280:Frem2 UTSW 3 53572423 missense probably damaging 1.00
R3196:Frem2 UTSW 3 53537331 missense probably damaging 1.00
R3716:Frem2 UTSW 3 53572360 missense probably damaging 1.00
R3807:Frem2 UTSW 3 53653449 missense probably benign 0.22
R3820:Frem2 UTSW 3 53516849 missense probably damaging 1.00
R3821:Frem2 UTSW 3 53652415 missense probably damaging 1.00
R3977:Frem2 UTSW 3 53652070 missense probably benign 0.00
R3979:Frem2 UTSW 3 53652070 missense probably benign 0.00
R4014:Frem2 UTSW 3 53652353 missense probably benign 0.01
R4127:Frem2 UTSW 3 53525896 missense probably damaging 1.00
R4195:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4196:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4374:Frem2 UTSW 3 53545502 missense possibly damaging 0.61
R4427:Frem2 UTSW 3 53539162 critical splice donor site probably null
R4428:Frem2 UTSW 3 53654338 missense probably benign 0.40
R4559:Frem2 UTSW 3 53654321 missense probably benign 0.01
R4600:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4602:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4610:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4611:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4661:Frem2 UTSW 3 53655443 missense probably damaging 1.00
R4678:Frem2 UTSW 3 53544371 missense probably benign 0.00
R4689:Frem2 UTSW 3 53547635 missense probably benign 0.43
R4740:Frem2 UTSW 3 53535819 missense probably benign 0.04
R4748:Frem2 UTSW 3 53541093 missense probably damaging 1.00
R4790:Frem2 UTSW 3 53516741 missense probably benign
R4809:Frem2 UTSW 3 53653895 missense probably benign 0.01
R4930:Frem2 UTSW 3 53656315 missense possibly damaging 0.93
R4971:Frem2 UTSW 3 53539183 missense probably damaging 1.00
R5057:Frem2 UTSW 3 53535196 missense probably benign 0.37
R5202:Frem2 UTSW 3 53551346 missense probably benign 0.41
R5221:Frem2 UTSW 3 53585611 missense probably damaging 1.00
R5231:Frem2 UTSW 3 53522295 missense probably damaging 1.00
R5268:Frem2 UTSW 3 53653154 missense probably damaging 0.96
R5480:Frem2 UTSW 3 53656507 nonsense probably null
R5637:Frem2 UTSW 3 53652937 missense probably damaging 0.97
R5664:Frem2 UTSW 3 53652490 missense probably benign 0.33
R5698:Frem2 UTSW 3 53652505 missense possibly damaging 0.89
R5744:Frem2 UTSW 3 53655959 missense probably damaging 1.00
R5754:Frem2 UTSW 3 53537258 missense probably damaging 1.00
R5808:Frem2 UTSW 3 53652563 missense probably damaging 0.96
R5840:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R5874:Frem2 UTSW 3 53537489 missense probably benign 0.21
R6050:Frem2 UTSW 3 53653012 missense probably damaging 0.99
R6103:Frem2 UTSW 3 53549788 missense probably benign 0.00
R6149:Frem2 UTSW 3 53551341 missense probably damaging 0.98
R6182:Frem2 UTSW 3 53647969 missense probably damaging 1.00
R6191:Frem2 UTSW 3 53655280 missense probably benign 0.10
R6245:Frem2 UTSW 3 53655824 missense probably benign 0.00
R6252:Frem2 UTSW 3 53572448 missense probably damaging 1.00
R6393:Frem2 UTSW 3 53585640 missense possibly damaging 0.91
R6416:Frem2 UTSW 3 53572378 missense probably benign 0.01
R6595:Frem2 UTSW 3 53549784 missense probably damaging 1.00
R6665:Frem2 UTSW 3 53654656 missense probably damaging 1.00
R6708:Frem2 UTSW 3 53585501 missense probably benign 0.00
R6751:Frem2 UTSW 3 53653665 missense probably damaging 1.00
R6787:Frem2 UTSW 3 53654323 missense probably benign 0.01
R6913:Frem2 UTSW 3 53516821 missense probably damaging 1.00
R6916:Frem2 UTSW 3 53547688 missense probably damaging 1.00
R7017:Frem2 UTSW 3 53519602 missense probably benign 0.02
R7083:Frem2 UTSW 3 53537493 missense probably damaging 0.99
R7108:Frem2 UTSW 3 53653513 missense probably damaging 1.00
R7133:Frem2 UTSW 3 53572339 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGGGTTTCACCACCACCATGAAGG -3'
(R):5'- GGCTCTAAAACGCGAACACTTCCAG -3'

Sequencing Primer
(F):5'- AAAGGGTCTGAGGCTGCTC -3'
(R):5'- AGGTGCTTGTGAGGATTCG -3'
Posted On2014-05-14