Incidental Mutation 'R1696:Akap13'
ID192229
Institutional Source Beutler Lab
Gene Symbol Akap13
Ensembl Gene ENSMUSG00000066406
Gene NameA kinase (PRKA) anchor protein 13
SynonymsAKAP-Lbc, 5730522G15Rik, 1700026G02Rik, PROTO-LBC, PROTO-LB, Ht31, 5830460E08Rik
MMRRC Submission 039729-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1696 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location75455534-75754609 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75609592 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 655 (G655S)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166315] [ENSMUST00000207750] [ENSMUST00000207923]
Predicted Effect possibly damaging
Transcript: ENSMUST00000147005
AA Change: G655S

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117686
Gene: ENSMUSG00000066406
AA Change: G655S

DomainStartEndE-ValueType
low complexity region 174 184 N/A INTRINSIC
internal_repeat_1 485 695 4.85e-5 PROSPERO
low complexity region 773 789 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1021 1032 N/A INTRINSIC
Pfam:RII_binding_1 1218 1235 4.3e-6 PFAM
low complexity region 1429 1444 N/A INTRINSIC
low complexity region 1479 1501 N/A INTRINSIC
low complexity region 1601 1612 N/A INTRINSIC
low complexity region 1738 1768 N/A INTRINSIC
C1 1773 1819 1.95e-4 SMART
low complexity region 1876 1887 N/A INTRINSIC
RhoGEF 1979 2171 1.28e-61 SMART
PH 2213 2316 2.94e-11 SMART
coiled coil region 2326 2363 N/A INTRINSIC
low complexity region 2411 2430 N/A INTRINSIC
low complexity region 2462 2472 N/A INTRINSIC
coiled coil region 2551 2664 N/A INTRINSIC
low complexity region 2746 2752 N/A INTRINSIC
low complexity region 2758 2771 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166315
AA Change: G655S

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129784
Gene: ENSMUSG00000066406
AA Change: G655S

DomainStartEndE-ValueType
low complexity region 174 184 N/A INTRINSIC
low complexity region 773 789 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1021 1032 N/A INTRINSIC
low complexity region 1433 1448 N/A INTRINSIC
low complexity region 1483 1505 N/A INTRINSIC
low complexity region 1583 1594 N/A INTRINSIC
low complexity region 1720 1750 N/A INTRINSIC
C1 1755 1801 1.95e-4 SMART
low complexity region 1858 1869 N/A INTRINSIC
RhoGEF 1961 2153 1.28e-61 SMART
PH 2195 2298 2.94e-11 SMART
coiled coil region 2308 2345 N/A INTRINSIC
low complexity region 2393 2412 N/A INTRINSIC
low complexity region 2444 2454 N/A INTRINSIC
coiled coil region 2533 2646 N/A INTRINSIC
low complexity region 2728 2734 N/A INTRINSIC
low complexity region 2740 2753 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207079
Predicted Effect possibly damaging
Transcript: ENSMUST00000207750
AA Change: G655S

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000207923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208456
Predicted Effect probably benign
Transcript: ENSMUST00000208708
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms containing c-terminal dbl oncogene homology (DH) and pleckstrin homology (PH) domains. The DH domain is associated with guanine nucleotide exchange activation for the Rho/Rac family of small GTP binding proteins, resulting in the conversion of the inactive GTPase to the active form capable of transducing signals. The PH domain has multiple functions. Therefore, these isoforms function as scaffolding proteins to coordinate a Rho signaling pathway, function as protein kinase A-anchoring proteins and, in addition, enhance ligand-dependent activity of estrogen receptors alpha and beta. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, arrested heart development, and forebrain hypoplasia. Heterozygous mice exhibit small spleen, impaired lymphocyte response to osmotic stress, decreased response to glucocorticoid, osteoporosis and impared osteogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,560,597 T25A possibly damaging Het
Abca17 T C 17: 24,267,658 Y1465C possibly damaging Het
Adgrb1 C T 15: 74,588,107 R530W probably damaging Het
Ak9 A G 10: 41,327,589 T159A possibly damaging Het
Amer2 T A 14: 60,379,674 D439E possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arfgef2 T A 2: 166,861,638 M870K probably damaging Het
Arhgef33 T C 17: 80,349,506 F150S probably damaging Het
Arid2 A T 15: 96,370,183 T726S probably benign Het
Atf7ip2 G A 16: 10,234,331 V225I probably damaging Het
Atp12a A T 14: 56,366,088 E50V probably damaging Het
Bdkrb1 A G 12: 105,604,502 N109S probably benign Het
Cald1 A G 6: 34,745,711 E104G probably damaging Het
Capn15 A G 17: 25,964,904 V267A probably benign Het
Ccng2 A T 5: 93,273,382 K250N possibly damaging Het
Ccr10 T A 11: 101,174,384 N107Y probably benign Het
Cntn2 T C 1: 132,521,279 N664S probably damaging Het
Cyp24a1 T G 2: 170,486,043 E426D probably benign Het
Cyp26a1 A G 19: 37,701,178 S441G probably benign Het
Cyp4f14 T A 17: 32,909,171 K290M possibly damaging Het
Dcp2 T A 18: 44,400,324 L114Q probably damaging Het
Dhrs7 A G 12: 72,653,120 F246S possibly damaging Het
Dlg1 T C 16: 31,781,798 V167A probably damaging Het
Dnmt3b A T 2: 153,676,710 K598* probably null Het
Dph7 T C 2: 24,969,680 probably null Het
Ehbp1 T C 11: 22,053,441 M1103V probably damaging Het
Ell2 T C 13: 75,769,558 S536P probably damaging Het
Ero1l A T 14: 45,299,935 V178E probably damaging Het
Faf2 T A 13: 54,638,254 *50R probably null Het
Fbxl14 A T 6: 119,480,146 N96I probably damaging Het
Fcrls T C 3: 87,259,518 Y56C possibly damaging Het
Foxc1 T A 13: 31,808,799 M531K unknown Het
Foxp1 A C 6: 98,945,702 S391A probably benign Het
Frem2 A T 3: 53,656,042 L348* probably null Het
Fsd1 T A 17: 55,988,257 probably null Het
Gab2 A G 7: 97,223,633 E81G probably damaging Het
Gcat G A 15: 79,035,795 V196M probably damaging Het
Gfy T C 7: 45,178,046 T209A possibly damaging Het
Ggt7 T C 2: 155,494,979 N531S possibly damaging Het
Gnai3 A G 3: 108,109,459 I343T probably damaging Het
H2-DMa A T 17: 34,138,413 Q220L probably benign Het
Heatr1 A G 13: 12,423,721 I1346V possibly damaging Het
Igfbp1 T A 11: 7,197,978 V7D probably benign Het
Igfbp1 T C 11: 7,201,922 W242R probably damaging Het
Kbtbd2 T G 6: 56,779,341 K470T probably benign Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Klhl25 G T 7: 75,866,843 G499V probably damaging Het
Krt7 A T 15: 101,423,426 T375S probably benign Het
Krt73 G A 15: 101,799,909 L238F probably damaging Het
Lama5 G T 2: 180,202,486 H331Q probably damaging Het
Leng8 T G 7: 4,145,136 F663V probably damaging Het
Lrp12 G T 15: 39,878,361 H338Q probably damaging Het
Lrp6 T A 6: 134,468,723 R1042S probably damaging Het
Map6 T A 7: 99,317,457 probably null Het
Mdn1 T C 4: 32,700,417 F1459L possibly damaging Het
Mmp1b T C 9: 7,386,699 T142A probably damaging Het
Mmp23 T A 4: 155,650,709 *392C probably null Het
Nlrp4a C T 7: 26,450,534 S522F probably damaging Het
Nup93 T G 8: 94,296,555 F254V probably benign Het
Oas1h G T 5: 120,862,822 probably null Het
Ocstamp A G 2: 165,396,174 L390P probably damaging Het
Olfm1 C A 2: 28,208,116 Y20* probably null Het
Olfr1111 A G 2: 87,150,380 F94L probably benign Het
Olfr455 C T 6: 42,538,603 V140M probably benign Het
Olfr541 A T 7: 140,704,496 K82* probably null Het
Olfr608 T C 7: 103,470,177 V46A probably benign Het
Olfr853 A G 9: 19,537,894 F12S probably damaging Het
Pgghg T C 7: 140,945,311 V410A possibly damaging Het
Polr2b T A 5: 77,342,648 D878E probably benign Het
Pspc1 T C 14: 56,764,243 T225A probably benign Het
Rad21l A T 2: 151,668,527 Y3N probably damaging Het
Rbl2 A G 8: 91,085,724 N280S probably benign Het
Rdm1 C A 11: 101,630,868 Q150K probably benign Het
Rrp12 A T 19: 41,873,749 F932I probably damaging Het
Ryr2 A T 13: 11,731,657 M2003K probably benign Het
Scfd2 T C 5: 74,530,878 T248A probably benign Het
Slc22a16 G A 10: 40,584,927 A242T possibly damaging Het
Slit3 C A 11: 35,675,923 N1007K probably damaging Het
Sntg2 C A 12: 30,267,063 G187C probably damaging Het
Spag5 T C 11: 78,321,326 V1060A probably damaging Het
Spg7 G A 8: 123,090,225 V552I probably benign Het
Spns2 T A 11: 72,456,347 T434S probably benign Het
Srpk2 C T 5: 23,548,494 W87* probably null Het
St3gal3 T C 4: 117,940,392 I268V possibly damaging Het
Stat6 T C 10: 127,653,049 C356R probably damaging Het
Stx8 A G 11: 68,011,422 Q144R probably damaging Het
Tcn2 C A 11: 3,922,169 L319F probably damaging Het
Tex14 T C 11: 87,511,545 I486T possibly damaging Het
Thtpa T C 14: 55,095,785 V109A probably benign Het
Tmem127 C A 2: 127,248,707 L48I probably damaging Het
Tnfaip8 A T 18: 50,090,223 K9* probably null Het
Tnfrsf1b T A 4: 145,227,474 T102S probably benign Het
Tor1aip1 A T 1: 156,017,516 M110K possibly damaging Het
Trim10 A T 17: 36,877,181 K430* probably null Het
Trove2 T A 1: 143,757,837 I508F probably damaging Het
Trpv6 A G 6: 41,621,768 V641A possibly damaging Het
Ttf1 T G 2: 29,070,002 Y541D probably damaging Het
Ttn A G 2: 76,764,406 V20432A probably damaging Het
Vac14 A T 8: 110,632,447 probably null Het
Vipr2 G T 12: 116,139,157 A296S probably benign Het
Vmn1r1 T C 1: 182,158,059 R14G probably benign Het
Vmn1r178 T A 7: 23,894,200 N151K probably damaging Het
Vmn1r58 T A 7: 5,410,728 I168F possibly damaging Het
Vmn1r77 C T 7: 12,041,620 Q40* probably null Het
Vmn2r76 T C 7: 86,231,256 N74S possibly damaging Het
Zc2hc1c T A 12: 85,290,781 M404K possibly damaging Het
Other mutations in Akap13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Akap13 APN 7 75725971 missense probably damaging 0.99
IGL00332:Akap13 APN 7 75728919 missense probably damaging 1.00
IGL00481:Akap13 APN 7 75723895 missense probably damaging 1.00
IGL00590:Akap13 APN 7 75610669 missense probably benign 0.01
IGL00655:Akap13 APN 7 75704398 missense probably damaging 0.99
IGL00766:Akap13 APN 7 75704512 missense probably damaging 0.96
IGL00818:Akap13 APN 7 75609727 missense probably benign 0.00
IGL00826:Akap13 APN 7 75677447 missense probably damaging 1.00
IGL01014:Akap13 APN 7 75750633 utr 3 prime probably benign
IGL01090:Akap13 APN 7 75666531 missense probably benign 0.44
IGL01155:Akap13 APN 7 75569936 missense probably damaging 1.00
IGL01326:Akap13 APN 7 75725348 missense probably benign 0.30
IGL01456:Akap13 APN 7 75602847 missense probably damaging 0.98
IGL01460:Akap13 APN 7 75747846 missense probably benign 0.29
IGL01568:Akap13 APN 7 75608522 nonsense probably null 0.00
IGL01610:Akap13 APN 7 75720180 missense possibly damaging 0.71
IGL01610:Akap13 APN 7 75747605 missense probably damaging 1.00
IGL01615:Akap13 APN 7 75697393 missense probably damaging 1.00
IGL01667:Akap13 APN 7 75570019 missense probably damaging 1.00
IGL01705:Akap13 APN 7 75746767 missense possibly damaging 0.86
IGL02070:Akap13 APN 7 75666545 missense probably benign 0.27
IGL02269:Akap13 APN 7 75602911 missense probably benign
IGL02421:Akap13 APN 7 75717806 missense possibly damaging 0.66
IGL02870:Akap13 APN 7 75609188 missense probably damaging 0.96
IGL02944:Akap13 APN 7 75608657 missense probably benign
IGL03051:Akap13 APN 7 75610485 nonsense probably null
IGL03160:Akap13 APN 7 75730417 missense probably damaging 1.00
IGL03245:Akap13 APN 7 75609752 missense probably damaging 0.99
R0254:Akap13 UTSW 7 75736604 splice site probably benign
R0310:Akap13 UTSW 7 75614930 missense probably damaging 0.99
R0373:Akap13 UTSW 7 75609929 missense probably benign 0.00
R0373:Akap13 UTSW 7 75730500 missense probably damaging 1.00
R0408:Akap13 UTSW 7 75746796 missense probably damaging 1.00
R0631:Akap13 UTSW 7 75614996 missense probably damaging 0.99
R0646:Akap13 UTSW 7 75747746 missense probably damaging 1.00
R0781:Akap13 UTSW 7 75611377 missense possibly damaging 0.56
R0845:Akap13 UTSW 7 75725380 missense probably damaging 1.00
R1004:Akap13 UTSW 7 75687286 missense probably damaging 0.99
R1024:Akap13 UTSW 7 75677409 missense probably damaging 1.00
R1110:Akap13 UTSW 7 75611377 missense possibly damaging 0.56
R1346:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1349:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1372:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1387:Akap13 UTSW 7 75586193 missense probably damaging 0.97
R1442:Akap13 UTSW 7 75735778 missense probably damaging 0.99
R1466:Akap13 UTSW 7 75729049 missense possibly damaging 0.79
R1466:Akap13 UTSW 7 75729049 missense possibly damaging 0.79
R1584:Akap13 UTSW 7 75729049 missense possibly damaging 0.79
R1738:Akap13 UTSW 7 75677194 missense probably damaging 1.00
R1773:Akap13 UTSW 7 75683451 missense possibly damaging 0.80
R1785:Akap13 UTSW 7 75611434 missense probably benign 0.16
R1786:Akap13 UTSW 7 75611434 missense probably benign 0.16
R1791:Akap13 UTSW 7 75611035 missense probably benign 0.00
R1819:Akap13 UTSW 7 75608705 missense probably benign 0.04
R1879:Akap13 UTSW 7 75610727 missense probably benign 0.01
R1989:Akap13 UTSW 7 75704516 missense probably benign 0.01
R2016:Akap13 UTSW 7 75704531 missense probably damaging 0.99
R2092:Akap13 UTSW 7 75610570 missense probably benign 0.05
R2126:Akap13 UTSW 7 75725304 missense possibly damaging 0.95
R2131:Akap13 UTSW 7 75611434 missense probably benign 0.16
R2132:Akap13 UTSW 7 75611434 missense probably benign 0.16
R2133:Akap13 UTSW 7 75611434 missense probably benign 0.16
R2251:Akap13 UTSW 7 75739477 missense possibly damaging 0.50
R3704:Akap13 UTSW 7 75666550 missense probably damaging 1.00
R3713:Akap13 UTSW 7 75586181 missense probably damaging 0.98
R3731:Akap13 UTSW 7 75611377 missense probably benign 0.39
R3765:Akap13 UTSW 7 75608837 missense probably benign 0.04
R3788:Akap13 UTSW 7 75702153 critical splice donor site probably null
R3793:Akap13 UTSW 7 75610141 missense probably benign 0.00
R3970:Akap13 UTSW 7 75569951 nonsense probably null
R4205:Akap13 UTSW 7 75610919 missense probably benign 0.05
R4257:Akap13 UTSW 7 75611285 missense probably damaging 0.98
R4374:Akap13 UTSW 7 75608984 missense probably damaging 0.96
R4448:Akap13 UTSW 7 75742760 missense probably damaging 1.00
R4450:Akap13 UTSW 7 75742760 missense probably damaging 1.00
R4457:Akap13 UTSW 7 75739465 missense probably damaging 0.99
R4458:Akap13 UTSW 7 75739465 missense probably damaging 0.99
R4466:Akap13 UTSW 7 75602773 splice site probably null
R4632:Akap13 UTSW 7 75666553 missense possibly damaging 0.91
R4667:Akap13 UTSW 7 75729094 missense probably damaging 1.00
R4669:Akap13 UTSW 7 75729094 missense probably damaging 1.00
R4671:Akap13 UTSW 7 75579564 nonsense probably null
R4821:Akap13 UTSW 7 75677507 intron probably benign
R4868:Akap13 UTSW 7 75743504 missense probably damaging 1.00
R4894:Akap13 UTSW 7 75725320 missense possibly damaging 0.76
R4943:Akap13 UTSW 7 75749240 missense probably benign 0.22
R4962:Akap13 UTSW 7 75749430 missense probably damaging 0.98
R4988:Akap13 UTSW 7 75730528 missense probably damaging 1.00
R5119:Akap13 UTSW 7 75687252 missense probably damaging 0.98
R5141:Akap13 UTSW 7 75609614 missense probably benign 0.18
R5419:Akap13 UTSW 7 75610243 missense probably benign 0.01
R5427:Akap13 UTSW 7 75728869 missense possibly damaging 0.89
R5429:Akap13 UTSW 7 75602904 missense possibly damaging 0.70
R5432:Akap13 UTSW 7 75602830 missense probably damaging 1.00
R5458:Akap13 UTSW 7 75586301 missense probably damaging 1.00
R5636:Akap13 UTSW 7 75704372 missense probably damaging 0.96
R5643:Akap13 UTSW 7 75702154 critical splice donor site probably null
R5898:Akap13 UTSW 7 75729146 missense probably damaging 1.00
R5932:Akap13 UTSW 7 75610184 missense probably damaging 1.00
R6135:Akap13 UTSW 7 75609908 missense possibly damaging 0.94
R6137:Akap13 UTSW 7 75677416 missense probably damaging 1.00
R6182:Akap13 UTSW 7 75586280 missense probably benign 0.45
R6310:Akap13 UTSW 7 75749193 missense probably damaging 0.99
R6346:Akap13 UTSW 7 75685254 missense probably damaging 1.00
R6466:Akap13 UTSW 7 75727044 missense probably benign 0.01
R6605:Akap13 UTSW 7 75579768 missense probably damaging 0.98
R6617:Akap13 UTSW 7 75730363 missense possibly damaging 0.95
R6621:Akap13 UTSW 7 75569981 missense probably damaging 1.00
R6703:Akap13 UTSW 7 75602898 missense probably damaging 1.00
R6750:Akap13 UTSW 7 75739458 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TAGCCTGCTTACCCCAGATGCTAC -3'
(R):5'- TCAGAAGTGACTGTGTCAGCTTGTG -3'

Sequencing Primer
(F):5'- CACCTGCATTGAGTTCTGAAG -3'
(R):5'- TGTCAGCTTGTGGGTCTTC -3'
Posted On2014-05-14