Incidental Mutation 'R1696:Pspc1'
ID192276
Institutional Source Beutler Lab
Gene Symbol Pspc1
Ensembl Gene ENSMUSG00000021938
Gene Nameparaspeckle protein 1
Synonyms5730470C09Rik, PSP1
MMRRC Submission 039729-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1696 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location56720710-56778316 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56764243 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 225 (T225A)
Ref Sequence ENSEMBL: ENSMUSP00000133038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022507] [ENSMUST00000163924]
Predicted Effect probably benign
Transcript: ENSMUST00000022507
AA Change: T225A

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022507
Gene: ENSMUSG00000021938
AA Change: T225A

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
RRM 82 149 8.91e-21 SMART
RRM 156 232 1.51e-9 SMART
low complexity region 298 310 N/A INTRINSIC
low complexity region 320 344 N/A INTRINSIC
low complexity region 350 376 N/A INTRINSIC
low complexity region 417 430 N/A INTRINSIC
low complexity region 433 452 N/A INTRINSIC
low complexity region 494 516 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163924
AA Change: T225A

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133038
Gene: ENSMUSG00000021938
AA Change: T225A

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
RRM 82 149 8.91e-21 SMART
RRM 156 232 1.51e-9 SMART
low complexity region 298 310 N/A INTRINSIC
low complexity region 320 344 N/A INTRINSIC
low complexity region 350 376 N/A INTRINSIC
low complexity region 417 430 N/A INTRINSIC
low complexity region 433 452 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168524
Predicted Effect unknown
Transcript: ENSMUST00000168575
AA Change: N46S
SMART Domains Protein: ENSMUSP00000125780
Gene: ENSMUSG00000021938
AA Change: N46S

DomainStartEndE-ValueType
RRM 5 56 2.12e-4 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein that localizes to punctate subnuclear structures that occur close to splicing speckles, known as paraspeckles. These paraspeckles are composed of RNA-protein structures that include a non-coding RNA, NEAT1/Men epsilon/beta, and the Drosophila Behavior Human Splicing family of proteins, which include the product of this gene and the P54NRB/NONO and PSF/SFPQ proteins. Paraspeckles may function in the control of gene expression via an RNA nuclear retention mechanism. The protein encoded by this gene is found in paraspeckles in transcriptionally active cells, but it localizes to unique cap structures at the nucleolar periphery when RNA polymerase II transcription is inhibited, or during telophase. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene, which is also located on chromosome 13, has been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a gene trap allele do not display any gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,560,597 T25A possibly damaging Het
Abca17 T C 17: 24,267,658 Y1465C possibly damaging Het
Adgrb1 C T 15: 74,588,107 R530W probably damaging Het
Ak9 A G 10: 41,327,589 T159A possibly damaging Het
Akap13 G A 7: 75,609,592 G655S possibly damaging Het
Amer2 T A 14: 60,379,674 D439E possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arfgef2 T A 2: 166,861,638 M870K probably damaging Het
Arhgef33 T C 17: 80,349,506 F150S probably damaging Het
Arid2 A T 15: 96,370,183 T726S probably benign Het
Atf7ip2 G A 16: 10,234,331 V225I probably damaging Het
Atp12a A T 14: 56,366,088 E50V probably damaging Het
Bdkrb1 A G 12: 105,604,502 N109S probably benign Het
Cald1 A G 6: 34,745,711 E104G probably damaging Het
Capn15 A G 17: 25,964,904 V267A probably benign Het
Ccng2 A T 5: 93,273,382 K250N possibly damaging Het
Ccr10 T A 11: 101,174,384 N107Y probably benign Het
Cntn2 T C 1: 132,521,279 N664S probably damaging Het
Cyp24a1 T G 2: 170,486,043 E426D probably benign Het
Cyp26a1 A G 19: 37,701,178 S441G probably benign Het
Cyp4f14 T A 17: 32,909,171 K290M possibly damaging Het
Dcp2 T A 18: 44,400,324 L114Q probably damaging Het
Dhrs7 A G 12: 72,653,120 F246S possibly damaging Het
Dlg1 T C 16: 31,781,798 V167A probably damaging Het
Dnmt3b A T 2: 153,676,710 K598* probably null Het
Dph7 T C 2: 24,969,680 probably null Het
Ehbp1 T C 11: 22,053,441 M1103V probably damaging Het
Ell2 T C 13: 75,769,558 S536P probably damaging Het
Ero1l A T 14: 45,299,935 V178E probably damaging Het
Faf2 T A 13: 54,638,254 *50R probably null Het
Fbxl14 A T 6: 119,480,146 N96I probably damaging Het
Fcrls T C 3: 87,259,518 Y56C possibly damaging Het
Foxc1 T A 13: 31,808,799 M531K unknown Het
Foxp1 A C 6: 98,945,702 S391A probably benign Het
Frem2 A T 3: 53,656,042 L348* probably null Het
Fsd1 T A 17: 55,988,257 probably null Het
Gab2 A G 7: 97,223,633 E81G probably damaging Het
Gcat G A 15: 79,035,795 V196M probably damaging Het
Gfy T C 7: 45,178,046 T209A possibly damaging Het
Ggt7 T C 2: 155,494,979 N531S possibly damaging Het
Gnai3 A G 3: 108,109,459 I343T probably damaging Het
H2-DMa A T 17: 34,138,413 Q220L probably benign Het
Heatr1 A G 13: 12,423,721 I1346V possibly damaging Het
Igfbp1 T A 11: 7,197,978 V7D probably benign Het
Igfbp1 T C 11: 7,201,922 W242R probably damaging Het
Kbtbd2 T G 6: 56,779,341 K470T probably benign Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Klhl25 G T 7: 75,866,843 G499V probably damaging Het
Krt7 A T 15: 101,423,426 T375S probably benign Het
Krt73 G A 15: 101,799,909 L238F probably damaging Het
Lama5 G T 2: 180,202,486 H331Q probably damaging Het
Leng8 T G 7: 4,145,136 F663V probably damaging Het
Lrp12 G T 15: 39,878,361 H338Q probably damaging Het
Lrp6 T A 6: 134,468,723 R1042S probably damaging Het
Map6 T A 7: 99,317,457 probably null Het
Mdn1 T C 4: 32,700,417 F1459L possibly damaging Het
Mmp1b T C 9: 7,386,699 T142A probably damaging Het
Mmp23 T A 4: 155,650,709 *392C probably null Het
Nlrp4a C T 7: 26,450,534 S522F probably damaging Het
Nup93 T G 8: 94,296,555 F254V probably benign Het
Oas1h G T 5: 120,862,822 probably null Het
Ocstamp A G 2: 165,396,174 L390P probably damaging Het
Olfm1 C A 2: 28,208,116 Y20* probably null Het
Olfr1111 A G 2: 87,150,380 F94L probably benign Het
Olfr455 C T 6: 42,538,603 V140M probably benign Het
Olfr541 A T 7: 140,704,496 K82* probably null Het
Olfr608 T C 7: 103,470,177 V46A probably benign Het
Olfr853 A G 9: 19,537,894 F12S probably damaging Het
Pgghg T C 7: 140,945,311 V410A possibly damaging Het
Polr2b T A 5: 77,342,648 D878E probably benign Het
Rad21l A T 2: 151,668,527 Y3N probably damaging Het
Rbl2 A G 8: 91,085,724 N280S probably benign Het
Rdm1 C A 11: 101,630,868 Q150K probably benign Het
Rrp12 A T 19: 41,873,749 F932I probably damaging Het
Ryr2 A T 13: 11,731,657 M2003K probably benign Het
Scfd2 T C 5: 74,530,878 T248A probably benign Het
Slc22a16 G A 10: 40,584,927 A242T possibly damaging Het
Slit3 C A 11: 35,675,923 N1007K probably damaging Het
Sntg2 C A 12: 30,267,063 G187C probably damaging Het
Spag5 T C 11: 78,321,326 V1060A probably damaging Het
Spg7 G A 8: 123,090,225 V552I probably benign Het
Spns2 T A 11: 72,456,347 T434S probably benign Het
Srpk2 C T 5: 23,548,494 W87* probably null Het
St3gal3 T C 4: 117,940,392 I268V possibly damaging Het
Stat6 T C 10: 127,653,049 C356R probably damaging Het
Stx8 A G 11: 68,011,422 Q144R probably damaging Het
Tcn2 C A 11: 3,922,169 L319F probably damaging Het
Tex14 T C 11: 87,511,545 I486T possibly damaging Het
Thtpa T C 14: 55,095,785 V109A probably benign Het
Tmem127 C A 2: 127,248,707 L48I probably damaging Het
Tnfaip8 A T 18: 50,090,223 K9* probably null Het
Tnfrsf1b T A 4: 145,227,474 T102S probably benign Het
Tor1aip1 A T 1: 156,017,516 M110K possibly damaging Het
Trim10 A T 17: 36,877,181 K430* probably null Het
Trove2 T A 1: 143,757,837 I508F probably damaging Het
Trpv6 A G 6: 41,621,768 V641A possibly damaging Het
Ttf1 T G 2: 29,070,002 Y541D probably damaging Het
Ttn A G 2: 76,764,406 V20432A probably damaging Het
Vac14 A T 8: 110,632,447 probably null Het
Vipr2 G T 12: 116,139,157 A296S probably benign Het
Vmn1r1 T C 1: 182,158,059 R14G probably benign Het
Vmn1r178 T A 7: 23,894,200 N151K probably damaging Het
Vmn1r58 T A 7: 5,410,728 I168F possibly damaging Het
Vmn1r77 C T 7: 12,041,620 Q40* probably null Het
Vmn2r76 T C 7: 86,231,256 N74S possibly damaging Het
Zc2hc1c T A 12: 85,290,781 M404K possibly damaging Het
Other mutations in Pspc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Pspc1 APN 14 56771711 missense probably damaging 1.00
IGL02281:Pspc1 APN 14 56723178 missense probably benign
IGL02954:Pspc1 APN 14 56771760 missense probably benign 0.17
IGL02989:Pspc1 APN 14 56771696 intron probably benign
R1549:Pspc1 UTSW 14 56748941 missense probably damaging 1.00
R4574:Pspc1 UTSW 14 56761947 missense possibly damaging 0.91
R4599:Pspc1 UTSW 14 56777789 critical splice donor site probably null
R5132:Pspc1 UTSW 14 56723250 missense probably benign 0.09
R5243:Pspc1 UTSW 14 56764191 missense probably damaging 1.00
R5519:Pspc1 UTSW 14 56771956 missense probably benign 0.11
R5610:Pspc1 UTSW 14 56777931 missense probably damaging 1.00
R5724:Pspc1 UTSW 14 56778072 missense probably benign 0.01
R5867:Pspc1 UTSW 14 56762041 splice site probably null
R5968:Pspc1 UTSW 14 56764236 missense probably benign 0.14
R6544:Pspc1 UTSW 14 56764203 makesense probably null
R7034:Pspc1 UTSW 14 56758628 critical splice donor site probably null
R7036:Pspc1 UTSW 14 56758628 critical splice donor site probably null
X0065:Pspc1 UTSW 14 56725415 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GACCAAACCGCTCATTAACCAGATTGTA -3'
(R):5'- GCAACCATGCCTACCTATTTTGGCAAAT -3'

Sequencing Primer
(F):5'- CAAGTCTTACTTATGGTACTGTTGAG -3'
(R):5'- tcctcctgcctcttcctc -3'
Posted On2014-05-14