Incidental Mutation 'R1696:Abca17'
ID192286
Institutional Source Beutler Lab
Gene Symbol Abca17
Ensembl Gene ENSMUSG00000035435
Gene NameATP-binding cassette, sub-family A (ABC1), member 17
Synonyms
MMRRC Submission 039729-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R1696 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24264259-24351029 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24267658 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1465 (Y1465C)
Ref Sequence ENSEMBL: ENSMUSP00000112538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039324
AA Change: Y1465C

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: Y1465C

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
transmembrane domain 22 44 N/A INTRINSIC
Pfam:ABC2_membrane_3 252 464 9.5e-17 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 6.7e-35 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121226
AA Change: Y1465C

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: Y1465C

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:ABC2_membrane_3 21 464 1.2e-15 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 1.1e-32 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,560,597 T25A possibly damaging Het
Adgrb1 C T 15: 74,588,107 R530W probably damaging Het
Ak9 A G 10: 41,327,589 T159A possibly damaging Het
Akap13 G A 7: 75,609,592 G655S possibly damaging Het
Amer2 T A 14: 60,379,674 D439E possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arfgef2 T A 2: 166,861,638 M870K probably damaging Het
Arhgef33 T C 17: 80,349,506 F150S probably damaging Het
Arid2 A T 15: 96,370,183 T726S probably benign Het
Atf7ip2 G A 16: 10,234,331 V225I probably damaging Het
Atp12a A T 14: 56,366,088 E50V probably damaging Het
Bdkrb1 A G 12: 105,604,502 N109S probably benign Het
Cald1 A G 6: 34,745,711 E104G probably damaging Het
Capn15 A G 17: 25,964,904 V267A probably benign Het
Ccng2 A T 5: 93,273,382 K250N possibly damaging Het
Ccr10 T A 11: 101,174,384 N107Y probably benign Het
Cntn2 T C 1: 132,521,279 N664S probably damaging Het
Cyp24a1 T G 2: 170,486,043 E426D probably benign Het
Cyp26a1 A G 19: 37,701,178 S441G probably benign Het
Cyp4f14 T A 17: 32,909,171 K290M possibly damaging Het
Dcp2 T A 18: 44,400,324 L114Q probably damaging Het
Dhrs7 A G 12: 72,653,120 F246S possibly damaging Het
Dlg1 T C 16: 31,781,798 V167A probably damaging Het
Dnmt3b A T 2: 153,676,710 K598* probably null Het
Dph7 T C 2: 24,969,680 probably null Het
Ehbp1 T C 11: 22,053,441 M1103V probably damaging Het
Ell2 T C 13: 75,769,558 S536P probably damaging Het
Ero1l A T 14: 45,299,935 V178E probably damaging Het
Faf2 T A 13: 54,638,254 *50R probably null Het
Fbxl14 A T 6: 119,480,146 N96I probably damaging Het
Fcrls T C 3: 87,259,518 Y56C possibly damaging Het
Foxc1 T A 13: 31,808,799 M531K unknown Het
Foxp1 A C 6: 98,945,702 S391A probably benign Het
Frem2 A T 3: 53,656,042 L348* probably null Het
Fsd1 T A 17: 55,988,257 probably null Het
Gab2 A G 7: 97,223,633 E81G probably damaging Het
Gcat G A 15: 79,035,795 V196M probably damaging Het
Gfy T C 7: 45,178,046 T209A possibly damaging Het
Ggt7 T C 2: 155,494,979 N531S possibly damaging Het
Gnai3 A G 3: 108,109,459 I343T probably damaging Het
H2-DMa A T 17: 34,138,413 Q220L probably benign Het
Heatr1 A G 13: 12,423,721 I1346V possibly damaging Het
Igfbp1 T A 11: 7,197,978 V7D probably benign Het
Igfbp1 T C 11: 7,201,922 W242R probably damaging Het
Kbtbd2 T G 6: 56,779,341 K470T probably benign Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Klhl25 G T 7: 75,866,843 G499V probably damaging Het
Krt7 A T 15: 101,423,426 T375S probably benign Het
Krt73 G A 15: 101,799,909 L238F probably damaging Het
Lama5 G T 2: 180,202,486 H331Q probably damaging Het
Leng8 T G 7: 4,145,136 F663V probably damaging Het
Lrp12 G T 15: 39,878,361 H338Q probably damaging Het
Lrp6 T A 6: 134,468,723 R1042S probably damaging Het
Map6 T A 7: 99,317,457 probably null Het
Mdn1 T C 4: 32,700,417 F1459L possibly damaging Het
Mmp1b T C 9: 7,386,699 T142A probably damaging Het
Mmp23 T A 4: 155,650,709 *392C probably null Het
Nlrp4a C T 7: 26,450,534 S522F probably damaging Het
Nup93 T G 8: 94,296,555 F254V probably benign Het
Oas1h G T 5: 120,862,822 probably null Het
Ocstamp A G 2: 165,396,174 L390P probably damaging Het
Olfm1 C A 2: 28,208,116 Y20* probably null Het
Olfr1111 A G 2: 87,150,380 F94L probably benign Het
Olfr455 C T 6: 42,538,603 V140M probably benign Het
Olfr541 A T 7: 140,704,496 K82* probably null Het
Olfr608 T C 7: 103,470,177 V46A probably benign Het
Olfr853 A G 9: 19,537,894 F12S probably damaging Het
Pgghg T C 7: 140,945,311 V410A possibly damaging Het
Polr2b T A 5: 77,342,648 D878E probably benign Het
Pspc1 T C 14: 56,764,243 T225A probably benign Het
Rad21l A T 2: 151,668,527 Y3N probably damaging Het
Rbl2 A G 8: 91,085,724 N280S probably benign Het
Rdm1 C A 11: 101,630,868 Q150K probably benign Het
Rrp12 A T 19: 41,873,749 F932I probably damaging Het
Ryr2 A T 13: 11,731,657 M2003K probably benign Het
Scfd2 T C 5: 74,530,878 T248A probably benign Het
Slc22a16 G A 10: 40,584,927 A242T possibly damaging Het
Slit3 C A 11: 35,675,923 N1007K probably damaging Het
Sntg2 C A 12: 30,267,063 G187C probably damaging Het
Spag5 T C 11: 78,321,326 V1060A probably damaging Het
Spg7 G A 8: 123,090,225 V552I probably benign Het
Spns2 T A 11: 72,456,347 T434S probably benign Het
Srpk2 C T 5: 23,548,494 W87* probably null Het
St3gal3 T C 4: 117,940,392 I268V possibly damaging Het
Stat6 T C 10: 127,653,049 C356R probably damaging Het
Stx8 A G 11: 68,011,422 Q144R probably damaging Het
Tcn2 C A 11: 3,922,169 L319F probably damaging Het
Tex14 T C 11: 87,511,545 I486T possibly damaging Het
Thtpa T C 14: 55,095,785 V109A probably benign Het
Tmem127 C A 2: 127,248,707 L48I probably damaging Het
Tnfaip8 A T 18: 50,090,223 K9* probably null Het
Tnfrsf1b T A 4: 145,227,474 T102S probably benign Het
Tor1aip1 A T 1: 156,017,516 M110K possibly damaging Het
Trim10 A T 17: 36,877,181 K430* probably null Het
Trove2 T A 1: 143,757,837 I508F probably damaging Het
Trpv6 A G 6: 41,621,768 V641A possibly damaging Het
Ttf1 T G 2: 29,070,002 Y541D probably damaging Het
Ttn A G 2: 76,764,406 V20432A probably damaging Het
Vac14 A T 8: 110,632,447 probably null Het
Vipr2 G T 12: 116,139,157 A296S probably benign Het
Vmn1r1 T C 1: 182,158,059 R14G probably benign Het
Vmn1r178 T A 7: 23,894,200 N151K probably damaging Het
Vmn1r58 T A 7: 5,410,728 I168F possibly damaging Het
Vmn1r77 C T 7: 12,041,620 Q40* probably null Het
Vmn2r76 T C 7: 86,231,256 N74S possibly damaging Het
Zc2hc1c T A 12: 85,290,781 M404K possibly damaging Het
Other mutations in Abca17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca17 APN 17 24295191 missense probably benign 0.14
IGL00585:Abca17 APN 17 24300320 missense probably damaging 0.99
IGL00941:Abca17 APN 17 24317130 missense probably damaging 1.00
IGL01987:Abca17 APN 17 24346228 missense probably benign 0.00
IGL01988:Abca17 APN 17 24334255 missense probably damaging 0.99
IGL02223:Abca17 APN 17 24287935 nonsense probably null
IGL02368:Abca17 APN 17 24287793 missense probably benign 0.01
IGL02405:Abca17 APN 17 24279062 missense possibly damaging 0.80
IGL02431:Abca17 APN 17 24298984 missense probably benign 0.05
IGL02607:Abca17 APN 17 24327705 nonsense probably null
IGL02706:Abca17 APN 17 24298992 missense probably benign 0.00
IGL02729:Abca17 APN 17 24280481 missense probably benign 0.06
IGL02818:Abca17 APN 17 24300352 missense probably benign 0.02
IGL02891:Abca17 APN 17 24281366 missense probably damaging 0.99
IGL03236:Abca17 APN 17 24326476 splice site probably benign
IGL03299:Abca17 APN 17 24265591 missense probably damaging 1.00
R0018:Abca17 UTSW 17 24313188 splice site probably null
R0467:Abca17 UTSW 17 24313177 splice site probably benign
R0671:Abca17 UTSW 17 24281249 missense probably benign 0.00
R1175:Abca17 UTSW 17 24289351 missense possibly damaging 0.91
R1397:Abca17 UTSW 17 24285759 missense probably benign 0.18
R1398:Abca17 UTSW 17 24328537 missense probably damaging 0.96
R1678:Abca17 UTSW 17 24335620 missense probably benign 0.05
R1781:Abca17 UTSW 17 24267557 missense possibly damaging 0.95
R1845:Abca17 UTSW 17 24267716 missense probably damaging 1.00
R1970:Abca17 UTSW 17 24307575 missense probably benign 0.00
R1997:Abca17 UTSW 17 24285726 missense probably benign 0.02
R2141:Abca17 UTSW 17 24334266 missense probably benign 0.00
R2199:Abca17 UTSW 17 24335624 missense probably benign 0.19
R2394:Abca17 UTSW 17 24281216 splice site probably null
R2442:Abca17 UTSW 17 24328632 missense probably benign 0.02
R2509:Abca17 UTSW 17 24289613 splice site probably benign
R2848:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2849:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2859:Abca17 UTSW 17 24281314 missense possibly damaging 0.46
R2879:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2935:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3153:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3154:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3434:Abca17 UTSW 17 24289537 missense probably damaging 1.00
R3695:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3905:Abca17 UTSW 17 24296283 missense probably benign 0.13
R4282:Abca17 UTSW 17 24299060 missense possibly damaging 0.49
R4334:Abca17 UTSW 17 24318268 missense probably damaging 1.00
R4350:Abca17 UTSW 17 24279046 critical splice donor site probably null
R4548:Abca17 UTSW 17 24334271 missense possibly damaging 0.82
R4626:Abca17 UTSW 17 24321084 missense probably damaging 1.00
R4722:Abca17 UTSW 17 24265429 missense probably damaging 1.00
R4745:Abca17 UTSW 17 24307453 missense probably damaging 1.00
R4818:Abca17 UTSW 17 24317161 missense probably damaging 0.98
R5279:Abca17 UTSW 17 24289414 missense probably damaging 1.00
R5310:Abca17 UTSW 17 24281230 missense probably benign 0.00
R5320:Abca17 UTSW 17 24307567 missense probably damaging 1.00
R5435:Abca17 UTSW 17 24267614 missense possibly damaging 0.90
R5622:Abca17 UTSW 17 24327668 missense probably benign 0.14
R5776:Abca17 UTSW 17 24295158 missense probably benign 0.09
R5928:Abca17 UTSW 17 24318185 missense probably benign 0.01
R6013:Abca17 UTSW 17 24287846 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6052:Abca17 UTSW 17 24318191 missense probably benign 0.00
R6063:Abca17 UTSW 17 24264344 missense unknown
R6404:Abca17 UTSW 17 24265918 missense probably benign 0.13
R6746:Abca17 UTSW 17 24346221 nonsense probably null
R6819:Abca17 UTSW 17 24287793 missense probably benign 0.01
R6828:Abca17 UTSW 17 24326415 missense possibly damaging 0.91
X0017:Abca17 UTSW 17 24317163 missense probably benign 0.26
X0065:Abca17 UTSW 17 24334284 missense probably damaging 1.00
Z1088:Abca17 UTSW 17 24279079 missense probably damaging 0.96
Z1088:Abca17 UTSW 17 24279107 missense probably benign 0.03
Z1088:Abca17 UTSW 17 24346219 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGCACAGCTCTTCTATGCCTGAC -3'
(R):5'- ACACATGGCTCCTTCATGCTGC -3'

Sequencing Primer
(F):5'- TGACAGGCTTTACTCTACAATCCAG -3'
(R):5'- CTGCATGAGTGTCCCTATAGTAGAC -3'
Posted On2014-05-14