Incidental Mutation 'R1697:Shf'
ID192307
Institutional Source Beutler Lab
Gene Symbol Shf
Ensembl Gene ENSMUSG00000033256
Gene NameSrc homology 2 domain containing F
Synonyms
MMRRC Submission 039730-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R1697 (G1)
Quality Score90
Status Validated
Chromosome2
Chromosomal Location122348892-122369162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122368682 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 51 (P51S)
Ref Sequence ENSEMBL: ENSMUSP00000106161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048635] [ENSMUST00000110531] [ENSMUST00000110532] [ENSMUST00000125826]
Predicted Effect probably benign
Transcript: ENSMUST00000048635
SMART Domains Protein: ENSMUSP00000045135
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 48 67 N/A INTRINSIC
SH2 136 220 9.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110531
SMART Domains Protein: ENSMUSP00000106160
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 48 67 N/A INTRINSIC
SH2 136 220 9.16e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110532
AA Change: P51S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106161
Gene: ENSMUSG00000033256
AA Change: P51S

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 45 61 N/A INTRINSIC
low complexity region 77 87 N/A INTRINSIC
low complexity region 146 165 N/A INTRINSIC
Blast:SH2 225 278 2e-22 BLAST
SCOP:d1ayaa_ 237 291 1e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125826
AA Change: P161S

PolyPhen 2 Score 0.433 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117099
Gene: ENSMUSG00000033256
AA Change: P161S

DomainStartEndE-ValueType
low complexity region 14 56 N/A INTRINSIC
low complexity region 76 105 N/A INTRINSIC
low complexity region 129 148 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 187 197 N/A INTRINSIC
low complexity region 256 275 N/A INTRINSIC
SH2 344 428 9.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151130
AA Change: P152S

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114524
Gene: ENSMUSG00000033256
AA Change: P152S

DomainStartEndE-ValueType
low complexity region 6 48 N/A INTRINSIC
low complexity region 68 97 N/A INTRINSIC
low complexity region 121 140 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
low complexity region 248 267 N/A INTRINSIC
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,845,114 D250E probably damaging Het
4930571K23Rik A G 7: 125,369,029 noncoding transcript Het
9530053A07Rik T A 7: 28,154,347 C1579S probably damaging Het
Acsl3 T C 1: 78,705,397 probably benign Het
Acsl6 C A 11: 54,329,966 T244K probably damaging Het
Adam26b T A 8: 43,520,963 N334I probably damaging Het
Adgrl4 C T 3: 151,517,611 T608M probably damaging Het
Aldh2 A G 5: 121,578,341 probably null Het
Alms1 A G 6: 85,622,454 T1890A possibly damaging Het
C87977 A C 4: 144,208,592 I193S probably damaging Het
Capn7 C T 14: 31,360,160 T441M probably damaging Het
Cd9 A T 6: 125,464,404 C85S probably damaging Het
Chrm3 T C 13: 9,878,758 T81A probably damaging Het
Ctif A G 18: 75,624,305 probably benign Het
Dcc T A 18: 71,370,737 D950V probably damaging Het
Eif4g1 T C 16: 20,679,780 V422A probably damaging Het
Enthd1 A G 15: 80,452,923 S437P probably damaging Het
Fads1 A G 19: 10,194,100 probably benign Het
Fat3 T A 9: 15,944,880 I3869L probably benign Het
Fbxw5 T A 2: 25,502,461 V85E possibly damaging Het
Fem1b T C 9: 62,797,174 D268G possibly damaging Het
Focad T C 4: 88,408,988 L1772P probably damaging Het
Gm9573 A C 17: 35,620,648 probably benign Het
Gm9833 G A 3: 10,089,553 V461I possibly damaging Het
Gtf3a C A 5: 146,951,913 Q145K possibly damaging Het
Hacl1 T C 14: 31,621,000 probably null Het
Herc2 T A 7: 56,153,905 F2229L probably benign Het
Hs3st4 A T 7: 124,396,857 I249L probably benign Het
Iqsec1 A T 6: 90,809,770 Y7* probably null Het
Klk1b1 T A 7: 43,970,326 M103K probably benign Het
Krt5 A G 15: 101,710,585 V287A probably benign Het
Lgals12 T A 19: 7,604,165 Q59L possibly damaging Het
Loxl4 A G 19: 42,604,940 V264A possibly damaging Het
Lrmp A G 6: 145,137,615 probably benign Het
Lrp1b T C 2: 40,822,683 D3099G probably damaging Het
Mical3 G A 6: 121,007,408 T169I possibly damaging Het
Myh7b A C 2: 155,620,134 S317R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nsd1 A T 13: 55,214,059 probably null Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr152 T A 2: 87,782,585 I15N possibly damaging Het
Olfr190 A G 16: 59,074,907 Y58H probably damaging Het
Olfr331 A T 11: 58,501,676 S293R probably damaging Het
Olfr346 C T 2: 36,688,247 L82F probably damaging Het
Olfr769 T C 10: 129,111,868 T186A probably benign Het
Pcnx2 A G 8: 125,850,348 Y982H probably damaging Het
Pias3 T C 3: 96,702,225 L312P probably damaging Het
Plekhm1 G A 11: 103,376,884 P754S probably damaging Het
Ppp2r5c T A 12: 110,545,623 L145* probably null Het
Ppp2r5c T A 12: 110,561,472 probably benign Het
Proser3 T C 7: 30,540,021 M553V probably benign Het
Smurf2 A T 11: 106,824,688 D664E possibly damaging Het
Spag9 G A 11: 93,996,565 A99T probably benign Het
Stim1 T G 7: 102,354,506 C49G probably damaging Het
Stk32c T C 7: 139,121,824 I238V probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tfb2m T A 1: 179,544,899 E133V probably null Het
Tmem209 A T 6: 30,497,868 C143S probably benign Het
Tnr T G 1: 159,852,030 N191K probably benign Het
Vars C T 17: 34,998,222 A419T probably benign Het
Vmn2r111 T C 17: 22,548,060 S819G probably benign Het
Wls T C 3: 159,897,358 V136A probably benign Het
Ybx2 C T 11: 69,940,061 S217L probably benign Het
Zfp82 T C 7: 30,057,354 D37G probably benign Het
Other mutations in Shf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02726:Shf APN 2 122359488 missense probably damaging 1.00
FR4589:Shf UTSW 2 122354177 small insertion probably benign
R0624:Shf UTSW 2 122368635 splice site probably benign
R0993:Shf UTSW 2 122368682 missense probably damaging 0.96
R1180:Shf UTSW 2 122368682 missense probably damaging 0.96
R1181:Shf UTSW 2 122368682 missense probably damaging 0.96
R1193:Shf UTSW 2 122368682 missense probably damaging 0.96
R1194:Shf UTSW 2 122368682 missense probably damaging 0.96
R1195:Shf UTSW 2 122368682 missense probably damaging 0.96
R1195:Shf UTSW 2 122368682 missense probably damaging 0.96
R1257:Shf UTSW 2 122368682 missense probably damaging 0.96
R1258:Shf UTSW 2 122368682 missense probably damaging 0.96
R1260:Shf UTSW 2 122368682 missense probably damaging 0.96
R1267:Shf UTSW 2 122368682 missense probably damaging 0.96
R1268:Shf UTSW 2 122368682 missense probably damaging 0.96
R1269:Shf UTSW 2 122368682 missense probably damaging 0.96
R1270:Shf UTSW 2 122368682 missense probably damaging 0.96
R1271:Shf UTSW 2 122368682 missense probably damaging 0.96
R1273:Shf UTSW 2 122368682 missense probably damaging 0.96
R1388:Shf UTSW 2 122368682 missense probably damaging 0.96
R1448:Shf UTSW 2 122368682 missense probably damaging 0.96
R1494:Shf UTSW 2 122368682 missense probably damaging 0.96
R1615:Shf UTSW 2 122349432 missense probably damaging 1.00
R1756:Shf UTSW 2 122368682 missense probably damaging 0.96
R1820:Shf UTSW 2 122368682 missense probably damaging 0.96
R1950:Shf UTSW 2 122368682 missense probably damaging 0.96
R3732:Shf UTSW 2 122345207 unclassified probably benign
R6794:Shf UTSW 2 122353840 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTAACAGGAAACAGGGCAGAGTT -3'
(R):5'- CAGCGGTGGAGTCGCAAAGT -3'

Sequencing Primer
(F):5'- GGTTAAAATTTGAGCCCCCG -3'
(R):5'- GAGCACCTGGGCTTTCG -3'
Posted On2014-05-14