Incidental Mutation 'R1697:Vmn2r111'
ID192362
Institutional Source Beutler Lab
Gene Symbol Vmn2r111
Ensembl Gene ENSMUSG00000095093
Gene Namevomeronasal 2, receptor 111
SynonymsEG210876
MMRRC Submission 039730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R1697 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location22547941-22573273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22548060 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 819 (S819G)
Ref Sequence ENSEMBL: ENSMUSP00000090148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092491]
Predicted Effect probably benign
Transcript: ENSMUST00000092491
AA Change: S819G

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: S819G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-29 PFAM
Pfam:NCD3G 512 565 1.1e-20 PFAM
Pfam:7tm_3 595 833 5.6e-54 PFAM
Meta Mutation Damage Score 0.1448 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,845,114 D250E probably damaging Het
4930571K23Rik A G 7: 125,369,029 noncoding transcript Het
9530053A07Rik T A 7: 28,154,347 C1579S probably damaging Het
Acsl3 T C 1: 78,705,397 probably benign Het
Acsl6 C A 11: 54,329,966 T244K probably damaging Het
Adam26b T A 8: 43,520,963 N334I probably damaging Het
Adgrl4 C T 3: 151,517,611 T608M probably damaging Het
Aldh2 A G 5: 121,578,341 probably null Het
Alms1 A G 6: 85,622,454 T1890A possibly damaging Het
C87977 A C 4: 144,208,592 I193S probably damaging Het
Capn7 C T 14: 31,360,160 T441M probably damaging Het
Cd9 A T 6: 125,464,404 C85S probably damaging Het
Chrm3 T C 13: 9,878,758 T81A probably damaging Het
Ctif A G 18: 75,624,305 probably benign Het
Dcc T A 18: 71,370,737 D950V probably damaging Het
Eif4g1 T C 16: 20,679,780 V422A probably damaging Het
Enthd1 A G 15: 80,452,923 S437P probably damaging Het
Fads1 A G 19: 10,194,100 probably benign Het
Fat3 T A 9: 15,944,880 I3869L probably benign Het
Fbxw5 T A 2: 25,502,461 V85E possibly damaging Het
Fem1b T C 9: 62,797,174 D268G possibly damaging Het
Focad T C 4: 88,408,988 L1772P probably damaging Het
Gm9573 A C 17: 35,620,648 probably benign Het
Gm9833 G A 3: 10,089,553 V461I possibly damaging Het
Gtf3a C A 5: 146,951,913 Q145K possibly damaging Het
Hacl1 T C 14: 31,621,000 probably null Het
Herc2 T A 7: 56,153,905 F2229L probably benign Het
Hs3st4 A T 7: 124,396,857 I249L probably benign Het
Iqsec1 A T 6: 90,809,770 Y7* probably null Het
Klk1b1 T A 7: 43,970,326 M103K probably benign Het
Krt5 A G 15: 101,710,585 V287A probably benign Het
Lgals12 T A 19: 7,604,165 Q59L possibly damaging Het
Loxl4 A G 19: 42,604,940 V264A possibly damaging Het
Lrmp A G 6: 145,137,615 probably benign Het
Lrp1b T C 2: 40,822,683 D3099G probably damaging Het
Mical3 G A 6: 121,007,408 T169I possibly damaging Het
Myh7b A C 2: 155,620,134 S317R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nsd1 A T 13: 55,214,059 probably null Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr152 T A 2: 87,782,585 I15N possibly damaging Het
Olfr190 A G 16: 59,074,907 Y58H probably damaging Het
Olfr331 A T 11: 58,501,676 S293R probably damaging Het
Olfr346 C T 2: 36,688,247 L82F probably damaging Het
Olfr769 T C 10: 129,111,868 T186A probably benign Het
Pcnx2 A G 8: 125,850,348 Y982H probably damaging Het
Pias3 T C 3: 96,702,225 L312P probably damaging Het
Plekhm1 G A 11: 103,376,884 P754S probably damaging Het
Ppp2r5c T A 12: 110,545,623 L145* probably null Het
Ppp2r5c T A 12: 110,561,472 probably benign Het
Proser3 T C 7: 30,540,021 M553V probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Smurf2 A T 11: 106,824,688 D664E possibly damaging Het
Spag9 G A 11: 93,996,565 A99T probably benign Het
Stim1 T G 7: 102,354,506 C49G probably damaging Het
Stk32c T C 7: 139,121,824 I238V probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tfb2m T A 1: 179,544,899 E133V probably null Het
Tmem209 A T 6: 30,497,868 C143S probably benign Het
Tnr T G 1: 159,852,030 N191K probably benign Het
Vars C T 17: 34,998,222 A419T probably benign Het
Wls T C 3: 159,897,358 V136A probably benign Het
Ybx2 C T 11: 69,940,061 S217L probably benign Het
Zfp82 T C 7: 30,057,354 D37G probably benign Het
Other mutations in Vmn2r111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Vmn2r111 APN 17 22548753 missense probably benign 0.00
IGL01306:Vmn2r111 APN 17 22568984 missense probably damaging 0.99
IGL01309:Vmn2r111 APN 17 22569016 missense possibly damaging 0.51
IGL01457:Vmn2r111 APN 17 22571985 nonsense probably null
IGL01465:Vmn2r111 APN 17 22548737 missense probably benign 0.00
IGL01505:Vmn2r111 APN 17 22548572 missense probably benign 0.00
IGL01571:Vmn2r111 APN 17 22571392 missense probably damaging 0.99
IGL01715:Vmn2r111 APN 17 22569073 splice site probably benign
IGL01962:Vmn2r111 APN 17 22548284 missense possibly damaging 0.90
IGL02190:Vmn2r111 APN 17 22570773 missense probably benign 0.00
IGL02496:Vmn2r111 APN 17 22568856 missense probably benign
IGL02519:Vmn2r111 APN 17 22548339 missense possibly damaging 0.80
IGL02616:Vmn2r111 APN 17 22571050 missense possibly damaging 0.67
IGL02641:Vmn2r111 APN 17 22573224 missense possibly damaging 0.82
IGL02690:Vmn2r111 APN 17 22559042 critical splice donor site probably null
IGL02698:Vmn2r111 APN 17 22571245 missense probably damaging 1.00
IGL03017:Vmn2r111 APN 17 22570858 missense probably damaging 1.00
R0046:Vmn2r111 UTSW 17 22548009 missense probably benign
R0064:Vmn2r111 UTSW 17 22572072 missense probably benign 0.00
R0519:Vmn2r111 UTSW 17 22573121 missense probably benign 0.02
R1439:Vmn2r111 UTSW 17 22571116 missense probably benign 0.00
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1636:Vmn2r111 UTSW 17 22571399 missense probably damaging 1.00
R1647:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1648:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1996:Vmn2r111 UTSW 17 22548081 missense probably benign 0.21
R2040:Vmn2r111 UTSW 17 22548414 missense probably damaging 1.00
R2075:Vmn2r111 UTSW 17 22559062 missense probably damaging 1.00
R2134:Vmn2r111 UTSW 17 22573104 missense possibly damaging 0.68
R2357:Vmn2r111 UTSW 17 22559170 splice site probably benign
R3700:Vmn2r111 UTSW 17 22571161 nonsense probably null
R3782:Vmn2r111 UTSW 17 22571320 missense possibly damaging 0.89
R4085:Vmn2r111 UTSW 17 22559115 missense probably benign 0.00
R4323:Vmn2r111 UTSW 17 22573178 missense probably benign 0.02
R4900:Vmn2r111 UTSW 17 22548656 missense possibly damaging 0.94
R5072:Vmn2r111 UTSW 17 22548041 missense probably damaging 0.99
R5123:Vmn2r111 UTSW 17 22571143 missense possibly damaging 0.82
R5181:Vmn2r111 UTSW 17 22571020 missense possibly damaging 0.56
R5357:Vmn2r111 UTSW 17 22548102 nonsense probably null
R5398:Vmn2r111 UTSW 17 22573271 start codon destroyed probably null 0.88
R5434:Vmn2r111 UTSW 17 22548489 missense probably damaging 0.99
R5462:Vmn2r111 UTSW 17 22548257 missense probably damaging 1.00
R6149:Vmn2r111 UTSW 17 22548815 missense probably benign 0.00
R6149:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6207:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6281:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6282:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6283:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6307:Vmn2r111 UTSW 17 22573089 missense probably benign 0.00
R6323:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6325:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6367:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6368:Vmn2r111 UTSW 17 22571908 missense probably benign 0.38
R6369:Vmn2r111 UTSW 17 22548602 missense probably damaging 1.00
R6489:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6490:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6546:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6547:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6557:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6654:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6655:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6657:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6659:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6660:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6664:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6798:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6799:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6801:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6893:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6895:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6897:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6922:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6923:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6944:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6945:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
X0026:Vmn2r111 UTSW 17 22548695 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCTTCAGGTACATATGCAGCACTAAAC -3'
(R):5'- CCAGAAACCTTCCTGGTGCCTTTAATG -3'

Sequencing Primer
(F):5'- TGCTAGGCAATATCCTTAGAGGAAAC -3'
(R):5'- CTGGTGCCTTTAATGAAGCC -3'
Posted On2014-05-14