Incidental Mutation 'R1699:Olfr1042'
ID192476
Institutional Source Beutler Lab
Gene Symbol Olfr1042
Ensembl Gene ENSMUSG00000075202
Gene Nameolfactory receptor 1042
SynonymsMOR185-10, GA_x6K02T2Q125-47629317-47628376
MMRRC Submission 039732-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R1699 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86156743-86161838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86159936 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 145 (I145V)
Ref Sequence ENSEMBL: ENSMUSP00000151053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099907] [ENSMUST00000099908] [ENSMUST00000213886] [ENSMUST00000213949] [ENSMUST00000215624] [ENSMUST00000216028]
Predicted Effect probably benign
Transcript: ENSMUST00000099907
SMART Domains Protein: ENSMUSP00000097491
Gene: ENSMUSG00000075201

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 6.9e-46 PFAM
Pfam:7tm_1 41 290 1.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099908
AA Change: I145V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097492
Gene: ENSMUSG00000075202
AA Change: I145V

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.2e-48 PFAM
Pfam:7tm_1 41 290 1.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213886
Predicted Effect probably benign
Transcript: ENSMUST00000213949
Predicted Effect probably benign
Transcript: ENSMUST00000215624
AA Change: I145V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216028
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A G 5: 30,483,866 probably null Het
Abca2 A G 2: 25,447,351 E2406G possibly damaging Het
Adam6b T A 12: 113,490,585 F341I probably benign Het
Adam8 A T 7: 139,983,311 N767K possibly damaging Het
AI481877 T C 4: 59,113,926 K13R unknown Het
Aig1 T C 10: 13,868,622 D46G possibly damaging Het
Alms1 A G 6: 85,622,880 I2032V possibly damaging Het
Ankrd16 A G 2: 11,784,393 I264V probably benign Het
Areg T G 5: 91,143,498 V100G probably damaging Het
Bcan A G 3: 87,989,236 Y718H probably damaging Het
Brsk2 T A 7: 141,985,463 I188N probably damaging Het
Ccdc189 A T 7: 127,586,856 probably null Het
Cdt1 T C 8: 122,569,983 Y203H probably damaging Het
Chil3 A C 3: 106,160,366 probably null Het
Cth A G 3: 157,907,436 L253P probably damaging Het
Cyp11b1 A G 15: 74,840,817 F132L possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnah11 A G 12: 118,190,868 S226P probably damaging Het
Egfr A T 11: 16,859,019 Q71L probably benign Het
Eml6 T A 11: 29,746,282 K1940* probably null Het
Epn2 T A 11: 61,523,188 K391* probably null Het
Erich1 A T 8: 14,090,259 S2T possibly damaging Het
Evi5 A C 5: 107,818,920 L245R probably damaging Het
Evpl T C 11: 116,227,588 Y731C probably damaging Het
Exoc3l G A 8: 105,295,013 H128Y probably benign Het
Extl1 G A 4: 134,364,583 Q320* probably null Het
Fam71a T A 1: 191,163,821 E208D probably benign Het
Fam91a1 T A 15: 58,432,948 S416T probably benign Het
Fam96b A G 8: 104,640,086 V132A probably damaging Het
Fat3 A T 9: 15,938,398 S3903T probably damaging Het
Fer1l4 A G 2: 156,029,685 F1392L probably benign Het
Fstl4 T C 11: 53,168,178 I488T possibly damaging Het
Gak A T 5: 108,604,377 Y338* probably null Het
Glp2r T C 11: 67,757,541 T112A probably benign Het
Glrb G A 3: 80,861,774 T180I probably damaging Het
Gm10118 C T 10: 63,926,892 probably benign Het
Gpr19 A T 6: 134,870,229 F72I possibly damaging Het
Grin3b C A 10: 79,975,882 N740K probably damaging Het
Gstk1 A T 6: 42,246,601 T42S probably benign Het
Hoxd1 G A 2: 74,764,282 A294T probably benign Het
Hspg2 T A 4: 137,548,012 probably null Het
Ift74 A T 4: 94,685,703 N472I probably benign Het
Il1a C T 2: 129,302,893 D202N probably damaging Het
Islr T C 9: 58,157,495 D243G probably damaging Het
Kif21a C T 15: 90,959,743 E1098K probably damaging Het
Krtap16-1 T C 11: 99,986,026 E184G probably damaging Het
Lrp1b A G 2: 41,185,962 I1889T possibly damaging Het
Mcpt4 A G 14: 56,059,959 *247Q probably null Het
Megf10 T C 18: 57,277,730 probably null Het
Mettl2 T A 11: 105,139,718 H373Q probably benign Het
Mocos A G 18: 24,683,216 K617E probably damaging Het
Ms4a8a A G 19: 11,076,397 I115T probably damaging Het
Ndst1 T C 18: 60,695,508 Y658C probably damaging Het
Nin G A 12: 70,030,938 A1031V probably benign Het
Nin C A 12: 70,045,563 K657N possibly damaging Het
Noc4l G A 5: 110,649,847 R344* probably null Het
Notch2 T C 3: 98,145,127 S1980P probably damaging Het
Npat C T 9: 53,562,660 S584L probably benign Het
Nphp4 A G 4: 152,496,664 T102A probably damaging Het
Olfml2b A G 1: 170,645,073 N51S possibly damaging Het
Olfr138 A G 17: 38,275,041 K90R probably benign Het
Olfr1388 T A 11: 49,444,289 I146N possibly damaging Het
Olfr153 A G 2: 87,532,083 T17A probably benign Het
Pced1b T A 15: 97,384,877 W266R probably damaging Het
Pdcd6ip A G 9: 113,678,354 V378A probably damaging Het
Pde8b T A 13: 95,032,866 K683N probably damaging Het
Pfas T G 11: 68,998,046 probably null Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plcd4 T G 1: 74,548,235 S51R probably benign Het
Plekhh2 T A 17: 84,577,184 Y775* probably null Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Ppp4r3b C T 11: 29,213,765 T47I possibly damaging Het
Pter A T 2: 12,994,761 D169V probably damaging Het
Ptpn12 A G 5: 20,998,170 S537P probably benign Het
Ptpru T A 4: 131,779,050 D1067V probably damaging Het
Rcn1 A T 2: 105,399,005 D67E probably damaging Het
Rfc4 T C 16: 23,114,233 E318G probably benign Het
Samd13 C A 3: 146,662,714 R41L probably benign Het
Slc6a2 T C 8: 92,972,812 I156T possibly damaging Het
Spag16 T C 1: 69,996,856 F348L probably benign Het
Spag4 T C 2: 156,065,422 Y21H probably damaging Het
Stam2 G A 2: 52,703,175 A368V possibly damaging Het
Stc1 A T 14: 69,038,327 M190L probably benign Het
Stxbp1 A G 2: 32,800,617 L475P probably damaging Het
Syn3 A T 10: 86,080,211 Y304N probably damaging Het
Tbc1d15 G T 10: 115,220,314 T251K probably benign Het
Tbpl2 A T 2: 24,095,045 M29K probably benign Het
Tead3 T G 17: 28,334,724 Q170H possibly damaging Het
Tpbpb T C 13: 60,902,163 N51D probably benign Het
Tstd3 A G 4: 21,759,400 M124T probably benign Het
Ttyh1 T A 7: 4,119,696 H14Q possibly damaging Het
Tubgcp4 G A 2: 121,189,893 W449* probably null Het
Txndc11 A G 16: 11,087,775 probably null Het
Usp24 T A 4: 106,438,827 D2615E probably damaging Het
Vars A G 17: 35,014,758 E1020G possibly damaging Het
Vmn2r58 A G 7: 41,860,527 I542T probably benign Het
Vwf A G 6: 125,643,069 Y1570C probably damaging Het
Vwf A T 6: 125,685,900 Y2749F possibly damaging Het
Zfand1 A C 3: 10,341,055 V198G possibly damaging Het
Zfp536 G A 7: 37,569,454 T179I probably damaging Het
Zfp599 T C 9: 22,250,404 Y155C probably benign Het
Other mutations in Olfr1042
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01914:Olfr1042 APN 2 86160047 missense probably benign 0.04
IGL02071:Olfr1042 APN 2 86159875 missense probably benign
IGL02935:Olfr1042 APN 2 86160370 unclassified probably benign
IGL03152:Olfr1042 APN 2 86159686 missense possibly damaging 0.95
R0089:Olfr1042 UTSW 2 86159574 missense possibly damaging 0.89
R1419:Olfr1042 UTSW 2 86159429 makesense probably null
R1804:Olfr1042 UTSW 2 86160073 missense probably benign 0.38
R3162:Olfr1042 UTSW 2 86160095 missense probably benign 0.03
R3162:Olfr1042 UTSW 2 86160095 missense probably benign 0.03
R3609:Olfr1042 UTSW 2 86159632 missense probably benign 0.00
R3953:Olfr1042 UTSW 2 86159938 missense probably benign 0.02
R3955:Olfr1042 UTSW 2 86159938 missense probably benign 0.02
R3956:Olfr1042 UTSW 2 86159938 missense probably benign 0.02
R3957:Olfr1042 UTSW 2 86159938 missense probably benign 0.02
R4771:Olfr1042 UTSW 2 86160073 missense probably benign 0.38
R5685:Olfr1042 UTSW 2 86159795 missense probably damaging 0.99
R6241:Olfr1042 UTSW 2 86160036 missense probably damaging 1.00
R6324:Olfr1042 UTSW 2 86159456 missense probably benign
R6678:Olfr1042 UTSW 2 86160185 missense probably damaging 0.98
R6921:Olfr1042 UTSW 2 86159852 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCCAGCAATGATTAGCAACATCAGC -3'
(R):5'- AGTGAGTCCTCAGCTTCATACCCC -3'

Sequencing Primer
(F):5'- GCAACATCAGCTCTTTGACATGAG -3'
(R):5'- CCAAACACTCTGGTGAATTTTCTACG -3'
Posted On2014-05-14