Incidental Mutation 'R1699:Dab1'
ID192493
Institutional Source Beutler Lab
Gene Symbol Dab1
Ensembl Gene ENSMUSG00000028519
Gene Namedisabled 1
SynonymsC630028C02Rik
MMRRC Submission 039732-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.592) question?
Stock #R1699 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location103619359-104744844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104731751 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 524 (A524V)
Ref Sequence ENSEMBL: ENSMUSP00000102443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106830] [ENSMUST00000146078]
Predicted Effect probably benign
Transcript: ENSMUST00000106830
AA Change: A524V

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102443
Gene: ENSMUSG00000028519
AA Change: A524V

DomainStartEndE-ValueType
PTB 37 171 3.51e-36 SMART
low complexity region 254 267 N/A INTRINSIC
low complexity region 470 487 N/A INTRINSIC
low complexity region 490 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146078
SMART Domains Protein: ENSMUSP00000125033
Gene: ENSMUSG00000028519

DomainStartEndE-ValueType
PTB 37 171 3.51e-36 SMART
low complexity region 235 242 N/A INTRINSIC
Meta Mutation Damage Score 0.212 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The laminar organization of multiple neuronal types in the cerebral cortex is required for normal cognitive function. In mice, the disabled-1 gene plays a central role in brain development, directing the migration of cortical neurons past previously formed neurons to reach their proper layer. This gene is similar to disabled-1, and the protein encoded by this gene is thought to be a signal transducer that interacts with protein kinase pathways to regulate neuronal positioning in the developing brain. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous null display unstable gait and whole-body tremor with a hypoplastic cerebellum devoid of folia, a probable consequence of defective neuronal migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A G 5: 30,483,866 probably null Het
Abca2 A G 2: 25,447,351 E2406G possibly damaging Het
Adam6b T A 12: 113,490,585 F341I probably benign Het
Adam8 A T 7: 139,983,311 N767K possibly damaging Het
AI481877 T C 4: 59,113,926 K13R unknown Het
Aig1 T C 10: 13,868,622 D46G possibly damaging Het
Alms1 A G 6: 85,622,880 I2032V possibly damaging Het
Ankrd16 A G 2: 11,784,393 I264V probably benign Het
Areg T G 5: 91,143,498 V100G probably damaging Het
Bcan A G 3: 87,989,236 Y718H probably damaging Het
Brsk2 T A 7: 141,985,463 I188N probably damaging Het
Ccdc189 A T 7: 127,586,856 probably null Het
Cdt1 T C 8: 122,569,983 Y203H probably damaging Het
Chil3 A C 3: 106,160,366 probably null Het
Cth A G 3: 157,907,436 L253P probably damaging Het
Cyp11b1 A G 15: 74,840,817 F132L possibly damaging Het
Dnah11 A G 12: 118,190,868 S226P probably damaging Het
Egfr A T 11: 16,859,019 Q71L probably benign Het
Eml6 T A 11: 29,746,282 K1940* probably null Het
Epn2 T A 11: 61,523,188 K391* probably null Het
Erich1 A T 8: 14,090,259 S2T possibly damaging Het
Evi5 A C 5: 107,818,920 L245R probably damaging Het
Evpl T C 11: 116,227,588 Y731C probably damaging Het
Exoc3l G A 8: 105,295,013 H128Y probably benign Het
Extl1 G A 4: 134,364,583 Q320* probably null Het
Fam71a T A 1: 191,163,821 E208D probably benign Het
Fam91a1 T A 15: 58,432,948 S416T probably benign Het
Fam96b A G 8: 104,640,086 V132A probably damaging Het
Fat3 A T 9: 15,938,398 S3903T probably damaging Het
Fer1l4 A G 2: 156,029,685 F1392L probably benign Het
Fstl4 T C 11: 53,168,178 I488T possibly damaging Het
Gak A T 5: 108,604,377 Y338* probably null Het
Glp2r T C 11: 67,757,541 T112A probably benign Het
Glrb G A 3: 80,861,774 T180I probably damaging Het
Gm10118 C T 10: 63,926,892 probably benign Het
Gpr19 A T 6: 134,870,229 F72I possibly damaging Het
Grin3b C A 10: 79,975,882 N740K probably damaging Het
Gstk1 A T 6: 42,246,601 T42S probably benign Het
Hoxd1 G A 2: 74,764,282 A294T probably benign Het
Hspg2 T A 4: 137,548,012 probably null Het
Ift74 A T 4: 94,685,703 N472I probably benign Het
Il1a C T 2: 129,302,893 D202N probably damaging Het
Islr T C 9: 58,157,495 D243G probably damaging Het
Kif21a C T 15: 90,959,743 E1098K probably damaging Het
Krtap16-1 T C 11: 99,986,026 E184G probably damaging Het
Lrp1b A G 2: 41,185,962 I1889T possibly damaging Het
Mcpt4 A G 14: 56,059,959 *247Q probably null Het
Megf10 T C 18: 57,277,730 probably null Het
Mettl2 T A 11: 105,139,718 H373Q probably benign Het
Mocos A G 18: 24,683,216 K617E probably damaging Het
Ms4a8a A G 19: 11,076,397 I115T probably damaging Het
Ndst1 T C 18: 60,695,508 Y658C probably damaging Het
Nin G A 12: 70,030,938 A1031V probably benign Het
Nin C A 12: 70,045,563 K657N possibly damaging Het
Noc4l G A 5: 110,649,847 R344* probably null Het
Notch2 T C 3: 98,145,127 S1980P probably damaging Het
Npat C T 9: 53,562,660 S584L probably benign Het
Nphp4 A G 4: 152,496,664 T102A probably damaging Het
Olfml2b A G 1: 170,645,073 N51S possibly damaging Het
Olfr1042 T C 2: 86,159,936 I145V probably benign Het
Olfr138 A G 17: 38,275,041 K90R probably benign Het
Olfr1388 T A 11: 49,444,289 I146N possibly damaging Het
Olfr153 A G 2: 87,532,083 T17A probably benign Het
Pced1b T A 15: 97,384,877 W266R probably damaging Het
Pdcd6ip A G 9: 113,678,354 V378A probably damaging Het
Pde8b T A 13: 95,032,866 K683N probably damaging Het
Pfas T G 11: 68,998,046 probably null Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plcd4 T G 1: 74,548,235 S51R probably benign Het
Plekhh2 T A 17: 84,577,184 Y775* probably null Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Ppp4r3b C T 11: 29,213,765 T47I possibly damaging Het
Pter A T 2: 12,994,761 D169V probably damaging Het
Ptpn12 A G 5: 20,998,170 S537P probably benign Het
Ptpru T A 4: 131,779,050 D1067V probably damaging Het
Rcn1 A T 2: 105,399,005 D67E probably damaging Het
Rfc4 T C 16: 23,114,233 E318G probably benign Het
Samd13 C A 3: 146,662,714 R41L probably benign Het
Slc6a2 T C 8: 92,972,812 I156T possibly damaging Het
Spag16 T C 1: 69,996,856 F348L probably benign Het
Spag4 T C 2: 156,065,422 Y21H probably damaging Het
Stam2 G A 2: 52,703,175 A368V possibly damaging Het
Stc1 A T 14: 69,038,327 M190L probably benign Het
Stxbp1 A G 2: 32,800,617 L475P probably damaging Het
Syn3 A T 10: 86,080,211 Y304N probably damaging Het
Tbc1d15 G T 10: 115,220,314 T251K probably benign Het
Tbpl2 A T 2: 24,095,045 M29K probably benign Het
Tead3 T G 17: 28,334,724 Q170H possibly damaging Het
Tpbpb T C 13: 60,902,163 N51D probably benign Het
Tstd3 A G 4: 21,759,400 M124T probably benign Het
Ttyh1 T A 7: 4,119,696 H14Q possibly damaging Het
Tubgcp4 G A 2: 121,189,893 W449* probably null Het
Txndc11 A G 16: 11,087,775 probably null Het
Usp24 T A 4: 106,438,827 D2615E probably damaging Het
Vars A G 17: 35,014,758 E1020G possibly damaging Het
Vmn2r58 A G 7: 41,860,527 I542T probably benign Het
Vwf A G 6: 125,643,069 Y1570C probably damaging Het
Vwf A T 6: 125,685,900 Y2749F possibly damaging Het
Zfand1 A C 3: 10,341,055 V198G possibly damaging Het
Zfp536 G A 7: 37,569,454 T179I probably damaging Het
Zfp599 T C 9: 22,250,404 Y155C probably benign Het
Other mutations in Dab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dab1 APN 4 104678810 missense probably damaging 1.00
IGL00087:Dab1 APN 4 104678753 missense possibly damaging 0.90
IGL00328:Dab1 APN 4 104688438 missense possibly damaging 0.55
IGL00756:Dab1 APN 4 104727878 missense probably benign
IGL02074:Dab1 APN 4 104727854 missense possibly damaging 0.90
IGL02286:Dab1 APN 4 104680070 missense probably damaging 1.00
IGL02986:Dab1 APN 4 104479221 missense probably benign 0.00
IGL03008:Dab1 APN 4 104727580 missense probably damaging 0.99
IGL03133:Dab1 APN 4 104727580 missense probably benign 0.41
IGL03375:Dab1 APN 4 104681601 missense possibly damaging 0.70
LCD18:Dab1 UTSW 4 104046572 intron probably benign
R0027:Dab1 UTSW 4 104704199 intron probably benign
R0466:Dab1 UTSW 4 104720550 missense probably benign 0.15
R0838:Dab1 UTSW 4 104731751 missense probably benign 0.29
R0840:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1086:Dab1 UTSW 4 104328572 intron probably benign
R1598:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1640:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1749:Dab1 UTSW 4 104328298 intron probably benign
R1770:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1846:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1847:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1848:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1885:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1986:Dab1 UTSW 4 104613215 missense probably damaging 0.97
R1990:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2006:Dab1 UTSW 4 104605325 missense probably damaging 1.00
R2030:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2032:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2034:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2061:Dab1 UTSW 4 104678741 missense probably damaging 1.00
R2088:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2089:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2091:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2091:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2092:Dab1 UTSW 4 104678777 missense probably damaging 1.00
R2193:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2194:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2361:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2362:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2391:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2424:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2865:Dab1 UTSW 4 104680146 missense probably benign
R3118:Dab1 UTSW 4 104680069 critical splice acceptor site probably null
R3716:Dab1 UTSW 4 104731751 missense probably benign 0.29
R3718:Dab1 UTSW 4 104731751 missense probably benign 0.29
R3740:Dab1 UTSW 4 104731751 missense probably benign 0.29
R3742:Dab1 UTSW 4 104731751 missense probably benign 0.29
R3965:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4057:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4393:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4396:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4418:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4607:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4608:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4648:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4693:Dab1 UTSW 4 104679553 missense probably damaging 1.00
R4701:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4730:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4760:Dab1 UTSW 4 104732145 missense probably damaging 1.00
R4927:Dab1 UTSW 4 104704252 missense probably benign
R5173:Dab1 UTSW 4 104688448 splice site probably null
R5503:Dab1 UTSW 4 104512264 missense probably benign 0.01
R6199:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6200:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6207:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6224:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6227:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6228:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6229:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6246:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6247:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6248:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6249:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6250:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6258:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6259:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6260:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6505:Dab1 UTSW 4 104512264 missense probably benign 0.01
R6817:Dab1 UTSW 4 104679546 missense probably damaging 1.00
Z1088:Dab1 UTSW 4 104479232 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCAGCTTGCTTGTGTGTCAGAAG -3'
(R):5'- GCCTGTGATCCATCAGGCTAGAAC -3'

Sequencing Primer
(F):5'- TGACTCAGTAGCTCTCCAGTAGG -3'
(R):5'- TTTACAGGAGGCTGAAACTTCCC -3'
Posted On2014-05-14