Incidental Mutation 'R1699:Usp24'
ID192494
Institutional Source Beutler Lab
Gene Symbol Usp24
Ensembl Gene ENSMUSG00000028514
Gene Nameubiquitin specific peptidase 24
Synonyms2810030C21Rik, 2700066K03Rik
MMRRC Submission 039732-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock #R1699 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location106316213-106441322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106438827 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 2615 (D2615E)
Ref Sequence ENSEMBL: ENSMUSP00000133095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049507] [ENSMUST00000094933] [ENSMUST00000165709]
Predicted Effect probably benign
Transcript: ENSMUST00000049507
SMART Domains Protein: ENSMUSP00000055757
Gene: ENSMUSG00000044254

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
Pfam:Peptidase_S8 180 438 3.1e-34 PFAM
low complexity region 471 481 N/A INTRINSIC
low complexity region 490 500 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094933
AA Change: D2614E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092538
Gene: ENSMUSG00000028514
AA Change: D2614E

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 882 6e-7 SMART
low complexity region 1031 1059 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1365 1378 N/A INTRINSIC
Pfam:UCH 1685 2036 3.7e-54 PFAM
Pfam:UCH_1 1686 1993 1.8e-27 PFAM
low complexity region 2066 2081 N/A INTRINSIC
low complexity region 2256 2267 N/A INTRINSIC
low complexity region 2576 2592 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165709
AA Change: D2615E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133095
Gene: ENSMUSG00000028514
AA Change: D2615E

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 883 8e-7 SMART
low complexity region 1032 1060 N/A INTRINSIC
low complexity region 1125 1151 N/A INTRINSIC
low complexity region 1366 1379 N/A INTRINSIC
Pfam:UCH 1686 2037 2e-49 PFAM
Pfam:UCH_1 1687 1994 4e-24 PFAM
low complexity region 2067 2082 N/A INTRINSIC
low complexity region 2257 2268 N/A INTRINSIC
low complexity region 2577 2593 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP24 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A G 5: 30,483,866 probably null Het
Abca2 A G 2: 25,447,351 E2406G possibly damaging Het
Adam6b T A 12: 113,490,585 F341I probably benign Het
Adam8 A T 7: 139,983,311 N767K possibly damaging Het
AI481877 T C 4: 59,113,926 K13R unknown Het
Aig1 T C 10: 13,868,622 D46G possibly damaging Het
Alms1 A G 6: 85,622,880 I2032V possibly damaging Het
Ankrd16 A G 2: 11,784,393 I264V probably benign Het
Areg T G 5: 91,143,498 V100G probably damaging Het
Bcan A G 3: 87,989,236 Y718H probably damaging Het
Brsk2 T A 7: 141,985,463 I188N probably damaging Het
Ccdc189 A T 7: 127,586,856 probably null Het
Cdt1 T C 8: 122,569,983 Y203H probably damaging Het
Chil3 A C 3: 106,160,366 probably null Het
Cth A G 3: 157,907,436 L253P probably damaging Het
Cyp11b1 A G 15: 74,840,817 F132L possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnah11 A G 12: 118,190,868 S226P probably damaging Het
Egfr A T 11: 16,859,019 Q71L probably benign Het
Eml6 T A 11: 29,746,282 K1940* probably null Het
Epn2 T A 11: 61,523,188 K391* probably null Het
Erich1 A T 8: 14,090,259 S2T possibly damaging Het
Evi5 A C 5: 107,818,920 L245R probably damaging Het
Evpl T C 11: 116,227,588 Y731C probably damaging Het
Exoc3l G A 8: 105,295,013 H128Y probably benign Het
Extl1 G A 4: 134,364,583 Q320* probably null Het
Fam71a T A 1: 191,163,821 E208D probably benign Het
Fam91a1 T A 15: 58,432,948 S416T probably benign Het
Fam96b A G 8: 104,640,086 V132A probably damaging Het
Fat3 A T 9: 15,938,398 S3903T probably damaging Het
Fer1l4 A G 2: 156,029,685 F1392L probably benign Het
Fstl4 T C 11: 53,168,178 I488T possibly damaging Het
Gak A T 5: 108,604,377 Y338* probably null Het
Glp2r T C 11: 67,757,541 T112A probably benign Het
Glrb G A 3: 80,861,774 T180I probably damaging Het
Gm10118 C T 10: 63,926,892 probably benign Het
Gpr19 A T 6: 134,870,229 F72I possibly damaging Het
Grin3b C A 10: 79,975,882 N740K probably damaging Het
Gstk1 A T 6: 42,246,601 T42S probably benign Het
Hoxd1 G A 2: 74,764,282 A294T probably benign Het
Hspg2 T A 4: 137,548,012 probably null Het
Ift74 A T 4: 94,685,703 N472I probably benign Het
Il1a C T 2: 129,302,893 D202N probably damaging Het
Islr T C 9: 58,157,495 D243G probably damaging Het
Kif21a C T 15: 90,959,743 E1098K probably damaging Het
Krtap16-1 T C 11: 99,986,026 E184G probably damaging Het
Lrp1b A G 2: 41,185,962 I1889T possibly damaging Het
Mcpt4 A G 14: 56,059,959 *247Q probably null Het
Megf10 T C 18: 57,277,730 probably null Het
Mettl2 T A 11: 105,139,718 H373Q probably benign Het
Mocos A G 18: 24,683,216 K617E probably damaging Het
Ms4a8a A G 19: 11,076,397 I115T probably damaging Het
Ndst1 T C 18: 60,695,508 Y658C probably damaging Het
Nin G A 12: 70,030,938 A1031V probably benign Het
Nin C A 12: 70,045,563 K657N possibly damaging Het
Noc4l G A 5: 110,649,847 R344* probably null Het
Notch2 T C 3: 98,145,127 S1980P probably damaging Het
Npat C T 9: 53,562,660 S584L probably benign Het
Nphp4 A G 4: 152,496,664 T102A probably damaging Het
Olfml2b A G 1: 170,645,073 N51S possibly damaging Het
Olfr1042 T C 2: 86,159,936 I145V probably benign Het
Olfr138 A G 17: 38,275,041 K90R probably benign Het
Olfr1388 T A 11: 49,444,289 I146N possibly damaging Het
Olfr153 A G 2: 87,532,083 T17A probably benign Het
Pced1b T A 15: 97,384,877 W266R probably damaging Het
Pdcd6ip A G 9: 113,678,354 V378A probably damaging Het
Pde8b T A 13: 95,032,866 K683N probably damaging Het
Pfas T G 11: 68,998,046 probably null Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plcd4 T G 1: 74,548,235 S51R probably benign Het
Plekhh2 T A 17: 84,577,184 Y775* probably null Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Ppp4r3b C T 11: 29,213,765 T47I possibly damaging Het
Pter A T 2: 12,994,761 D169V probably damaging Het
Ptpn12 A G 5: 20,998,170 S537P probably benign Het
Ptpru T A 4: 131,779,050 D1067V probably damaging Het
Rcn1 A T 2: 105,399,005 D67E probably damaging Het
Rfc4 T C 16: 23,114,233 E318G probably benign Het
Samd13 C A 3: 146,662,714 R41L probably benign Het
Slc6a2 T C 8: 92,972,812 I156T possibly damaging Het
Spag16 T C 1: 69,996,856 F348L probably benign Het
Spag4 T C 2: 156,065,422 Y21H probably damaging Het
Stam2 G A 2: 52,703,175 A368V possibly damaging Het
Stc1 A T 14: 69,038,327 M190L probably benign Het
Stxbp1 A G 2: 32,800,617 L475P probably damaging Het
Syn3 A T 10: 86,080,211 Y304N probably damaging Het
Tbc1d15 G T 10: 115,220,314 T251K probably benign Het
Tbpl2 A T 2: 24,095,045 M29K probably benign Het
Tead3 T G 17: 28,334,724 Q170H possibly damaging Het
Tpbpb T C 13: 60,902,163 N51D probably benign Het
Tstd3 A G 4: 21,759,400 M124T probably benign Het
Ttyh1 T A 7: 4,119,696 H14Q possibly damaging Het
Tubgcp4 G A 2: 121,189,893 W449* probably null Het
Txndc11 A G 16: 11,087,775 probably null Het
Vars A G 17: 35,014,758 E1020G possibly damaging Het
Vmn2r58 A G 7: 41,860,527 I542T probably benign Het
Vwf A G 6: 125,643,069 Y1570C probably damaging Het
Vwf A T 6: 125,685,900 Y2749F possibly damaging Het
Zfand1 A C 3: 10,341,055 V198G possibly damaging Het
Zfp536 G A 7: 37,569,454 T179I probably damaging Het
Zfp599 T C 9: 22,250,404 Y155C probably benign Het
Other mutations in Usp24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Usp24 APN 4 106359091 missense probably benign
IGL00340:Usp24 APN 4 106401139 missense probably damaging 0.99
IGL00480:Usp24 APN 4 106368106 missense probably damaging 0.99
IGL00548:Usp24 APN 4 106341298 missense probably damaging 0.96
IGL00655:Usp24 APN 4 106390318 missense probably damaging 0.99
IGL00674:Usp24 APN 4 106372679 splice site probably benign
IGL00718:Usp24 APN 4 106409704 missense probably benign 0.10
IGL00803:Usp24 APN 4 106385526 splice site probably benign
IGL01161:Usp24 APN 4 106436844 missense probably benign 0.02
IGL01344:Usp24 APN 4 106379385 missense possibly damaging 0.73
IGL01374:Usp24 APN 4 106380099 missense possibly damaging 0.86
IGL01485:Usp24 APN 4 106362232 missense probably benign 0.01
IGL01736:Usp24 APN 4 106423461 missense probably benign 0.00
IGL01737:Usp24 APN 4 106387734 missense probably benign 0.03
IGL01862:Usp24 APN 4 106408898 splice site probably benign
IGL01981:Usp24 APN 4 106375768 splice site probably benign
IGL02090:Usp24 APN 4 106411426 missense possibly damaging 0.55
IGL02275:Usp24 APN 4 106387493 missense probably damaging 1.00
IGL02352:Usp24 APN 4 106403925 missense probably damaging 1.00
IGL02359:Usp24 APN 4 106403925 missense probably damaging 1.00
IGL02391:Usp24 APN 4 106407129 missense possibly damaging 0.60
IGL02418:Usp24 APN 4 106436360 missense probably benign 0.07
IGL02537:Usp24 APN 4 106392367 missense probably damaging 1.00
IGL02638:Usp24 APN 4 106438770 splice site probably benign
IGL02638:Usp24 APN 4 106438772 splice site probably benign
IGL02830:Usp24 APN 4 106347387 missense possibly damaging 0.79
IGL03125:Usp24 APN 4 106392402 missense probably benign 0.09
IGL03280:Usp24 APN 4 106380430 missense probably damaging 1.00
IGL03350:Usp24 APN 4 106371079 nonsense probably null
IGL03098:Usp24 UTSW 4 106371033 missense probably benign 0.11
R0035:Usp24 UTSW 4 106368027 missense probably benign 0.18
R0044:Usp24 UTSW 4 106412084 splice site probably benign
R0086:Usp24 UTSW 4 106392360 missense probably damaging 0.98
R0125:Usp24 UTSW 4 106397299 missense possibly damaging 0.76
R0197:Usp24 UTSW 4 106407133 missense probably damaging 1.00
R0240:Usp24 UTSW 4 106414404 nonsense probably null
R0240:Usp24 UTSW 4 106414404 nonsense probably null
R0491:Usp24 UTSW 4 106402105 missense probably benign 0.41
R0687:Usp24 UTSW 4 106420504 missense probably damaging 1.00
R0973:Usp24 UTSW 4 106371079 nonsense probably null
R0973:Usp24 UTSW 4 106413678 splice site probably null
R0973:Usp24 UTSW 4 106371079 nonsense probably null
R0974:Usp24 UTSW 4 106371079 nonsense probably null
R0974:Usp24 UTSW 4 106413678 splice site probably null
R1163:Usp24 UTSW 4 106420960 missense probably benign
R1293:Usp24 UTSW 4 106423553 missense probably benign 0.19
R1333:Usp24 UTSW 4 106342353 missense possibly damaging 0.55
R1476:Usp24 UTSW 4 106361933 missense probably damaging 1.00
R1728:Usp24 UTSW 4 106360421 missense possibly damaging 0.85
R1729:Usp24 UTSW 4 106360421 missense possibly damaging 0.85
R1753:Usp24 UTSW 4 106377559 missense probably benign 0.04
R1917:Usp24 UTSW 4 106410286 missense probably damaging 1.00
R2045:Usp24 UTSW 4 106400980 missense possibly damaging 0.54
R2424:Usp24 UTSW 4 106399113 critical splice donor site probably null
R2436:Usp24 UTSW 4 106409645 nonsense probably null
R2513:Usp24 UTSW 4 106379405 splice site probably null
R3824:Usp24 UTSW 4 106379066 missense probably benign
R3831:Usp24 UTSW 4 106362012 critical splice donor site probably null
R3833:Usp24 UTSW 4 106362012 critical splice donor site probably null
R3982:Usp24 UTSW 4 106387883 missense probably benign 0.38
R4022:Usp24 UTSW 4 106379224 splice site probably benign
R4067:Usp24 UTSW 4 106359089 missense possibly damaging 0.68
R4175:Usp24 UTSW 4 106316773 missense probably benign 0.00
R4766:Usp24 UTSW 4 106416048 missense probably damaging 1.00
R4771:Usp24 UTSW 4 106362180 synonymous probably null
R4798:Usp24 UTSW 4 106360162 missense possibly damaging 0.82
R4809:Usp24 UTSW 4 106413676 critical splice donor site probably null
R4822:Usp24 UTSW 4 106416047 missense probably damaging 0.98
R4906:Usp24 UTSW 4 106388637 missense probably benign 0.20
R4934:Usp24 UTSW 4 106426546 missense probably benign 0.29
R5074:Usp24 UTSW 4 106420447 missense probably benign 0.12
R5151:Usp24 UTSW 4 106399112 critical splice donor site probably null
R5220:Usp24 UTSW 4 106382303 missense possibly damaging 0.69
R5279:Usp24 UTSW 4 106385424 missense possibly damaging 0.94
R5280:Usp24 UTSW 4 106341214 missense probably benign 0.18
R5285:Usp24 UTSW 4 106407033 missense probably benign 0.00
R5292:Usp24 UTSW 4 106418263 missense probably benign 0.06
R5294:Usp24 UTSW 4 106362357 missense possibly damaging 0.53
R5394:Usp24 UTSW 4 106408013 missense probably damaging 1.00
R5517:Usp24 UTSW 4 106375674 missense probably benign 0.02
R5522:Usp24 UTSW 4 106372721 missense probably damaging 1.00
R5546:Usp24 UTSW 4 106416047 missense probably damaging 0.98
R5756:Usp24 UTSW 4 106362483 missense probably damaging 1.00
R5910:Usp24 UTSW 4 106380468 missense probably damaging 0.99
R5972:Usp24 UTSW 4 106368067 missense probably damaging 0.98
R6285:Usp24 UTSW 4 106374100 intron probably null
R6370:Usp24 UTSW 4 106380521 missense probably null 0.20
R6630:Usp24 UTSW 4 106387835 missense possibly damaging 0.69
R6754:Usp24 UTSW 4 106360420 missense probably damaging 1.00
X0024:Usp24 UTSW 4 106360446 missense probably benign 0.09
X0028:Usp24 UTSW 4 106368055 missense probably benign 0.01
X0066:Usp24 UTSW 4 106355731 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CTGGTGGCTTAGTAAGACCACACG -3'
(R):5'- ATGCACATGTAGACGCTGGGAC -3'

Sequencing Primer
(F):5'- GCAAATGCTTTGCATGACCC -3'
(R):5'- AGCTGGTCCACATTGCAGAA -3'
Posted On2014-05-14