Incidental Mutation 'R1699:Fat3'
ID192525
Institutional Source Beutler Lab
Gene Symbol Fat3
Ensembl Gene ENSMUSG00000074505
Gene NameFAT atypical cadherin 3
Synonyms9430076A06Rik, D430038H04Rik, LOC382129, LOC234973
MMRRC Submission 039732-MU
Accession Numbers

Genbank: NM_001080814; MGI: 2444314

Is this an essential gene? Possibly non essential (E-score: 0.391) question?
Stock #R1699 (G1)
Quality Score173
Status Not validated
Chromosome9
Chromosomal Location15910189-16501285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 15938398 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 3903 (S3903T)
Ref Sequence ENSEMBL: ENSMUSP00000148968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082170] [ENSMUST00000217308]
Predicted Effect probably damaging
Transcript: ENSMUST00000082170
AA Change: S3903T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080808
Gene: ENSMUSG00000074505
AA Change: S3903T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 65 151 3e-7 SMART
CA 175 259 8.9e-22 SMART
CA 280 368 8.9e-4 SMART
CA 389 465 2.6e-11 SMART
CA 489 571 2e-29 SMART
low complexity region 684 697 N/A INTRINSIC
CA 743 824 1e-24 SMART
low complexity region 830 840 N/A INTRINSIC
CA 848 929 7.6e-26 SMART
CA 953 1034 1.5e-25 SMART
CA 1060 1141 6.6e-32 SMART
CA 1165 1247 1.5e-30 SMART
CA 1273 1349 1.8e-8 SMART
CA 1375 1453 2.9e-12 SMART
CA 1477 1559 3e-22 SMART
CA 1583 1664 3.1e-16 SMART
CA 1688 1762 4.2e-22 SMART
CA 1793 1876 2.5e-26 SMART
CA 1900 1975 1.5e-8 SMART
low complexity region 1983 1994 N/A INTRINSIC
CA 1999 2077 1.4e-18 SMART
CA 2101 2179 6.6e-10 SMART
CA 2203 2280 4.9e-19 SMART
CA 2304 2387 4.3e-29 SMART
CA 2411 2489 4.2e-11 SMART
CA 2513 2593 2.8e-22 SMART
CA 2617 2701 4.3e-10 SMART
CA 2719 2807 2.5e-7 SMART
CA 2831 2917 3.3e-27 SMART
CA 2941 3022 9.4e-23 SMART
CA 3046 3124 2.4e-26 SMART
CA 3148 3229 1.3e-32 SMART
CA 3253 3334 1.3e-29 SMART
CA 3358 3439 4.9e-28 SMART
CA 3463 3544 6.4e-12 SMART
EGF 3793 3828 1.3e-1 SMART
LamG 3852 3989 4.3e-25 SMART
EGF 4019 4053 2.7e-6 SMART
EGF 4058 4091 4.5e-6 SMART
EGF_CA 4093 4129 3.9e-11 SMART
transmembrane domain 4151 4170 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215388
Predicted Effect probably damaging
Transcript: ENSMUST00000217308
AA Change: S3903T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozgyous for a knock-out allele exhibit abnormal amacrine cell differentiation and migration that result in the formation of two additional plexiform layers and thickened retinal ganglion layer. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A G 5: 30,483,866 probably null Het
Abca2 A G 2: 25,447,351 E2406G possibly damaging Het
Adam6b T A 12: 113,490,585 F341I probably benign Het
Adam8 A T 7: 139,983,311 N767K possibly damaging Het
AI481877 T C 4: 59,113,926 K13R unknown Het
Aig1 T C 10: 13,868,622 D46G possibly damaging Het
Alms1 A G 6: 85,622,880 I2032V possibly damaging Het
Ankrd16 A G 2: 11,784,393 I264V probably benign Het
Areg T G 5: 91,143,498 V100G probably damaging Het
Bcan A G 3: 87,989,236 Y718H probably damaging Het
Brsk2 T A 7: 141,985,463 I188N probably damaging Het
Ccdc189 A T 7: 127,586,856 probably null Het
Cdt1 T C 8: 122,569,983 Y203H probably damaging Het
Chil3 A C 3: 106,160,366 probably null Het
Cth A G 3: 157,907,436 L253P probably damaging Het
Cyp11b1 A G 15: 74,840,817 F132L possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnah11 A G 12: 118,190,868 S226P probably damaging Het
Egfr A T 11: 16,859,019 Q71L probably benign Het
Eml6 T A 11: 29,746,282 K1940* probably null Het
Epn2 T A 11: 61,523,188 K391* probably null Het
Erich1 A T 8: 14,090,259 S2T possibly damaging Het
Evi5 A C 5: 107,818,920 L245R probably damaging Het
Evpl T C 11: 116,227,588 Y731C probably damaging Het
Exoc3l G A 8: 105,295,013 H128Y probably benign Het
Extl1 G A 4: 134,364,583 Q320* probably null Het
Fam71a T A 1: 191,163,821 E208D probably benign Het
Fam91a1 T A 15: 58,432,948 S416T probably benign Het
Fam96b A G 8: 104,640,086 V132A probably damaging Het
Fer1l4 A G 2: 156,029,685 F1392L probably benign Het
Fstl4 T C 11: 53,168,178 I488T possibly damaging Het
Gak A T 5: 108,604,377 Y338* probably null Het
Glp2r T C 11: 67,757,541 T112A probably benign Het
Glrb G A 3: 80,861,774 T180I probably damaging Het
Gm10118 C T 10: 63,926,892 probably benign Het
Gpr19 A T 6: 134,870,229 F72I possibly damaging Het
Grin3b C A 10: 79,975,882 N740K probably damaging Het
Gstk1 A T 6: 42,246,601 T42S probably benign Het
Hoxd1 G A 2: 74,764,282 A294T probably benign Het
Hspg2 T A 4: 137,548,012 probably null Het
Ift74 A T 4: 94,685,703 N472I probably benign Het
Il1a C T 2: 129,302,893 D202N probably damaging Het
Islr T C 9: 58,157,495 D243G probably damaging Het
Kif21a C T 15: 90,959,743 E1098K probably damaging Het
Krtap16-1 T C 11: 99,986,026 E184G probably damaging Het
Lrp1b A G 2: 41,185,962 I1889T possibly damaging Het
Mcpt4 A G 14: 56,059,959 *247Q probably null Het
Megf10 T C 18: 57,277,730 probably null Het
Mettl2 T A 11: 105,139,718 H373Q probably benign Het
Mocos A G 18: 24,683,216 K617E probably damaging Het
Ms4a8a A G 19: 11,076,397 I115T probably damaging Het
Ndst1 T C 18: 60,695,508 Y658C probably damaging Het
Nin G A 12: 70,030,938 A1031V probably benign Het
Nin C A 12: 70,045,563 K657N possibly damaging Het
Noc4l G A 5: 110,649,847 R344* probably null Het
Notch2 T C 3: 98,145,127 S1980P probably damaging Het
Npat C T 9: 53,562,660 S584L probably benign Het
Nphp4 A G 4: 152,496,664 T102A probably damaging Het
Olfml2b A G 1: 170,645,073 N51S possibly damaging Het
Olfr1042 T C 2: 86,159,936 I145V probably benign Het
Olfr138 A G 17: 38,275,041 K90R probably benign Het
Olfr1388 T A 11: 49,444,289 I146N possibly damaging Het
Olfr153 A G 2: 87,532,083 T17A probably benign Het
Pced1b T A 15: 97,384,877 W266R probably damaging Het
Pdcd6ip A G 9: 113,678,354 V378A probably damaging Het
Pde8b T A 13: 95,032,866 K683N probably damaging Het
Pfas T G 11: 68,998,046 probably null Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plcd4 T G 1: 74,548,235 S51R probably benign Het
Plekhh2 T A 17: 84,577,184 Y775* probably null Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Ppp4r3b C T 11: 29,213,765 T47I possibly damaging Het
Pter A T 2: 12,994,761 D169V probably damaging Het
Ptpn12 A G 5: 20,998,170 S537P probably benign Het
Ptpru T A 4: 131,779,050 D1067V probably damaging Het
Rcn1 A T 2: 105,399,005 D67E probably damaging Het
Rfc4 T C 16: 23,114,233 E318G probably benign Het
Samd13 C A 3: 146,662,714 R41L probably benign Het
Slc6a2 T C 8: 92,972,812 I156T possibly damaging Het
Spag16 T C 1: 69,996,856 F348L probably benign Het
Spag4 T C 2: 156,065,422 Y21H probably damaging Het
Stam2 G A 2: 52,703,175 A368V possibly damaging Het
Stc1 A T 14: 69,038,327 M190L probably benign Het
Stxbp1 A G 2: 32,800,617 L475P probably damaging Het
Syn3 A T 10: 86,080,211 Y304N probably damaging Het
Tbc1d15 G T 10: 115,220,314 T251K probably benign Het
Tbpl2 A T 2: 24,095,045 M29K probably benign Het
Tead3 T G 17: 28,334,724 Q170H possibly damaging Het
Tpbpb T C 13: 60,902,163 N51D probably benign Het
Tstd3 A G 4: 21,759,400 M124T probably benign Het
Ttyh1 T A 7: 4,119,696 H14Q possibly damaging Het
Tubgcp4 G A 2: 121,189,893 W449* probably null Het
Txndc11 A G 16: 11,087,775 probably null Het
Usp24 T A 4: 106,438,827 D2615E probably damaging Het
Vars A G 17: 35,014,758 E1020G possibly damaging Het
Vmn2r58 A G 7: 41,860,527 I542T probably benign Het
Vwf A G 6: 125,643,069 Y1570C probably damaging Het
Vwf A T 6: 125,685,900 Y2749F possibly damaging Het
Zfand1 A C 3: 10,341,055 V198G possibly damaging Het
Zfp536 G A 7: 37,569,454 T179I probably damaging Het
Zfp599 T C 9: 22,250,404 Y155C probably benign Het
Other mutations in Fat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Fat3 APN 9 15996427 missense possibly damaging 0.77
IGL00962:Fat3 APN 9 15915519 missense probably benign 0.14
IGL00966:Fat3 APN 9 15999094 missense possibly damaging 0.69
IGL01100:Fat3 APN 9 16375228 missense probably damaging 1.00
IGL01104:Fat3 APN 9 16375728 missense possibly damaging 0.92
IGL01104:Fat3 APN 9 15998460 missense probably damaging 1.00
IGL01121:Fat3 APN 9 15998401 missense probably benign 0.00
IGL01407:Fat3 APN 9 16378023 missense probably benign 0.01
IGL01444:Fat3 APN 9 15998848 missense probably damaging 1.00
IGL01634:Fat3 APN 9 15998358 missense probably damaging 1.00
IGL01649:Fat3 APN 9 16376719 missense possibly damaging 0.95
IGL01839:Fat3 APN 9 15997872 missense probably damaging 1.00
IGL01867:Fat3 APN 9 16377901 missense probably benign 0.03
IGL01894:Fat3 APN 9 16375849 missense probably benign
IGL01913:Fat3 APN 9 15998790 missense probably damaging 0.99
IGL02033:Fat3 APN 9 15915352 missense possibly damaging 0.50
IGL02035:Fat3 APN 9 16377970 missense probably benign 0.06
IGL02146:Fat3 APN 9 15999582 missense probably benign
IGL02147:Fat3 APN 9 15995985 missense probably damaging 1.00
IGL02161:Fat3 APN 9 15997050 missense probably benign 0.10
IGL02161:Fat3 APN 9 15997051 nonsense probably null
IGL02164:Fat3 APN 9 16031424 splice site probably benign
IGL02269:Fat3 APN 9 15915577 missense possibly damaging 0.84
IGL02314:Fat3 APN 9 15969838 missense possibly damaging 0.61
IGL02393:Fat3 APN 9 15988412 nonsense probably null
IGL02410:Fat3 APN 9 15997845 missense probably damaging 1.00
IGL02504:Fat3 APN 9 15959798 missense probably damaging 1.00
IGL02572:Fat3 APN 9 15960506 missense probably benign
IGL02623:Fat3 APN 9 15997137 missense probably damaging 1.00
IGL02654:Fat3 APN 9 15996975 missense possibly damaging 0.84
IGL02749:Fat3 APN 9 16006711 missense possibly damaging 0.93
IGL02810:Fat3 APN 9 16376850 missense probably damaging 1.00
IGL02839:Fat3 APN 9 15919170 missense probably damaging 1.00
IGL02890:Fat3 APN 9 15915340 missense probably benign 0.03
IGL02892:Fat3 APN 9 16377562 missense probably damaging 1.00
IGL03090:Fat3 APN 9 16377239 nonsense probably null
IGL03144:Fat3 APN 9 16375245 missense probably damaging 1.00
IGL03199:Fat3 APN 9 16377048 missense possibly damaging 0.83
IGL03365:Fat3 APN 9 15996469 missense probably damaging 1.00
IGL03392:Fat3 APN 9 16003862 missense probably benign
IGL03408:Fat3 APN 9 15997957 nonsense probably null
gagged UTSW 9 15998271 missense probably damaging 1.00
Muffled UTSW 9 15937991 critical splice donor site probably null
F6893:Fat3 UTSW 9 16006789 missense probably damaging 0.99
IGL03050:Fat3 UTSW 9 15996600 missense probably benign 0.04
PIT4142001:Fat3 UTSW 9 15992118 critical splice donor site probably null
R0001:Fat3 UTSW 9 16377873 missense probably damaging 0.99
R0005:Fat3 UTSW 9 15962866 missense probably damaging 1.00
R0005:Fat3 UTSW 9 15962866 missense probably damaging 1.00
R0038:Fat3 UTSW 9 15915010 missense probably damaging 1.00
R0046:Fat3 UTSW 9 15965979 missense possibly damaging 0.65
R0089:Fat3 UTSW 9 15938205 missense probably benign
R0135:Fat3 UTSW 9 16006777 missense probably damaging 1.00
R0255:Fat3 UTSW 9 15969706 splice site probably benign
R0349:Fat3 UTSW 9 16031180 missense probably damaging 1.00
R0361:Fat3 UTSW 9 15998403 missense possibly damaging 0.77
R0382:Fat3 UTSW 9 15959756 missense probably damaging 1.00
R0418:Fat3 UTSW 9 16246896 missense probably damaging 1.00
R0419:Fat3 UTSW 9 15992256 missense probably damaging 1.00
R0437:Fat3 UTSW 9 15996932 missense probably damaging 1.00
R0441:Fat3 UTSW 9 15945008 splice site probably benign
R0480:Fat3 UTSW 9 15997729 missense probably benign 0.00
R0510:Fat3 UTSW 9 15999685 nonsense probably null
R0665:Fat3 UTSW 9 15997402 missense probably benign
R0715:Fat3 UTSW 9 16375123 missense probably benign
R0727:Fat3 UTSW 9 15996699 missense probably damaging 1.00
R0882:Fat3 UTSW 9 16031368 missense possibly damaging 0.84
R0946:Fat3 UTSW 9 15997804 missense possibly damaging 0.95
R1068:Fat3 UTSW 9 15970034 missense probably benign
R1081:Fat3 UTSW 9 16375284 missense possibly damaging 0.62
R1082:Fat3 UTSW 9 16006615 missense probably damaging 1.00
R1148:Fat3 UTSW 9 15996774 missense probably damaging 1.00
R1148:Fat3 UTSW 9 15996774 missense probably damaging 1.00
R1233:Fat3 UTSW 9 15922745 missense probably benign
R1306:Fat3 UTSW 9 16376679 missense probably damaging 1.00
R1311:Fat3 UTSW 9 16021410 missense probably damaging 1.00
R1338:Fat3 UTSW 9 15925091 missense probably benign 0.00
R1395:Fat3 UTSW 9 16246916 missense probably benign 0.00
R1466:Fat3 UTSW 9 16375482 missense probably damaging 0.96
R1466:Fat3 UTSW 9 16375482 missense probably damaging 0.96
R1510:Fat3 UTSW 9 15960055 missense probably damaging 1.00
R1528:Fat3 UTSW 9 15925091 missense probably benign 0.00
R1531:Fat3 UTSW 9 15997465 missense probably damaging 1.00
R1659:Fat3 UTSW 9 15997183 missense possibly damaging 0.91
R1697:Fat3 UTSW 9 15944880 missense probably benign 0.05
R1728:Fat3 UTSW 9 15996315 missense possibly damaging 0.65
R1729:Fat3 UTSW 9 15996315 missense possibly damaging 0.65
R1731:Fat3 UTSW 9 15995937 missense probably benign
R1784:Fat3 UTSW 9 15996315 missense possibly damaging 0.65
R1789:Fat3 UTSW 9 16376985 missense probably benign 0.00
R1794:Fat3 UTSW 9 15997136 nonsense probably null
R1794:Fat3 UTSW 9 15997138 missense probably benign 0.15
R1830:Fat3 UTSW 9 15915340 missense probably benign 0.03
R1835:Fat3 UTSW 9 15998088 missense probably damaging 1.00
R1887:Fat3 UTSW 9 15967061 missense probably damaging 1.00
R1898:Fat3 UTSW 9 15960130 missense probably damaging 1.00
R1909:Fat3 UTSW 9 15998115 missense probably benign
R1912:Fat3 UTSW 9 15969988 missense probably damaging 1.00
R1917:Fat3 UTSW 9 15997057 missense possibly damaging 0.55
R1967:Fat3 UTSW 9 15968295 missense probably benign 0.00
R2070:Fat3 UTSW 9 15999370 missense probably benign 0.21
R2100:Fat3 UTSW 9 16377430 missense possibly damaging 0.73
R2104:Fat3 UTSW 9 15998517 missense possibly damaging 0.77
R2113:Fat3 UTSW 9 15999786 missense probably damaging 1.00
R2132:Fat3 UTSW 9 16246719 critical splice donor site probably null
R2136:Fat3 UTSW 9 16377051 missense probably benign 0.01
R2146:Fat3 UTSW 9 15990512 missense probably benign 0.01
R2233:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2234:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2273:Fat3 UTSW 9 15915262 missense probably benign
R2285:Fat3 UTSW 9 16376173 missense probably damaging 1.00
R2363:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2365:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2367:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2403:Fat3 UTSW 9 15969871 missense probably damaging 1.00
R2447:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2496:Fat3 UTSW 9 15966103 missense probably benign 0.01
R2509:Fat3 UTSW 9 15925014 missense possibly damaging 0.82
R2932:Fat3 UTSW 9 16375944 missense probably damaging 1.00
R2986:Fat3 UTSW 9 15992128 missense probably damaging 1.00
R3054:Fat3 UTSW 9 15960496 missense probably benign
R3056:Fat3 UTSW 9 15960496 missense probably benign
R3729:Fat3 UTSW 9 16247041 splice site probably benign
R3745:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3806:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3859:Fat3 UTSW 9 15997228 nonsense probably null
R3862:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3890:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3892:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3950:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3972:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4004:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4005:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4086:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4111:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4113:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4227:Fat3 UTSW 9 16377693 missense probably damaging 1.00
R4352:Fat3 UTSW 9 16246778 missense possibly damaging 0.55
R4394:Fat3 UTSW 9 15922792 missense probably benign 0.11
R4403:Fat3 UTSW 9 15944873 missense probably damaging 1.00
R4433:Fat3 UTSW 9 16031152 missense probably damaging 0.99
R4453:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4479:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4480:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4521:Fat3 UTSW 9 15922942 missense probably null 0.71
R4620:Fat3 UTSW 9 15996894 missense probably damaging 1.00
R4700:Fat3 UTSW 9 16031173 missense probably damaging 1.00
R4721:Fat3 UTSW 9 16029966 missense probably damaging 1.00
R4790:Fat3 UTSW 9 15998484 missense probably damaging 1.00
R4796:Fat3 UTSW 9 15999732 missense probably benign 0.17
R4823:Fat3 UTSW 9 15996507 missense probably benign
R4836:Fat3 UTSW 9 16377723 missense probably damaging 1.00
R4842:Fat3 UTSW 9 15997587 missense probably damaging 1.00
R4849:Fat3 UTSW 9 16377948 missense probably benign 0.03
R4856:Fat3 UTSW 9 16021330 missense probably benign
R4869:Fat3 UTSW 9 16377477 missense probably damaging 0.98
R4886:Fat3 UTSW 9 16021330 missense probably benign
R4899:Fat3 UTSW 9 15969799 missense probably damaging 1.00
R4941:Fat3 UTSW 9 16375152 missense probably damaging 1.00
R4986:Fat3 UTSW 9 15998340 missense probably damaging 1.00
R5058:Fat3 UTSW 9 15996858 missense probably damaging 1.00
R5079:Fat3 UTSW 9 15999127 missense probably benign 0.01
R5080:Fat3 UTSW 9 15999338 missense probably benign 0.35
R5174:Fat3 UTSW 9 15999570 missense probably damaging 1.00
R5183:Fat3 UTSW 9 15960313 missense probably damaging 0.99
R5203:Fat3 UTSW 9 16378142 missense possibly damaging 0.79
R5216:Fat3 UTSW 9 16377537 missense probably damaging 1.00
R5230:Fat3 UTSW 9 15990560 missense possibly damaging 0.51
R5318:Fat3 UTSW 9 16376629 missense probably damaging 1.00
R5377:Fat3 UTSW 9 16376443 missense probably benign 0.05
R5385:Fat3 UTSW 9 15922675 missense possibly damaging 0.82
R5436:Fat3 UTSW 9 15960514 missense probably benign 0.02
R5437:Fat3 UTSW 9 16085308 missense probably damaging 1.00
R5453:Fat3 UTSW 9 15996864 missense probably damaging 1.00
R5460:Fat3 UTSW 9 15919167 missense probably damaging 1.00
R5516:Fat3 UTSW 9 15998709 missense probably damaging 1.00
R5568:Fat3 UTSW 9 16376923 nonsense probably null
R5628:Fat3 UTSW 9 15966096 missense probably damaging 1.00
R5835:Fat3 UTSW 9 16375833 missense probably damaging 1.00
R5845:Fat3 UTSW 9 16377210 missense probably damaging 1.00
R5898:Fat3 UTSW 9 15938461 missense probably benign 0.15
R5941:Fat3 UTSW 9 15999501 missense probably benign 0.07
R5974:Fat3 UTSW 9 16006528 critical splice donor site probably null
R5986:Fat3 UTSW 9 15998317 missense probably benign 0.22
R6015:Fat3 UTSW 9 16376050 missense possibly damaging 0.55
R6031:Fat3 UTSW 9 15988492 missense probably benign 0.02
R6031:Fat3 UTSW 9 15988492 missense probably benign 0.02
R6042:Fat3 UTSW 9 16377817 missense probably benign 0.12
R6051:Fat3 UTSW 9 16375455 missense possibly damaging 0.83
R6052:Fat3 UTSW 9 15922679 missense probably null
R6119:Fat3 UTSW 9 16376568 missense possibly damaging 0.82
R6161:Fat3 UTSW 9 16377522 missense probably damaging 1.00
R6254:Fat3 UTSW 9 15996145 missense probably benign 0.19
R6318:Fat3 UTSW 9 15916984 intron probably benign
R6347:Fat3 UTSW 9 15998372 missense probably damaging 1.00
R6348:Fat3 UTSW 9 15937991 critical splice donor site probably null
R6351:Fat3 UTSW 9 15938398 missense probably damaging 1.00
R6450:Fat3 UTSW 9 15999170 missense possibly damaging 0.51
R6460:Fat3 UTSW 9 15967000 missense probably damaging 1.00
R6524:Fat3 UTSW 9 15992256 missense probably damaging 1.00
R6533:Fat3 UTSW 9 15998899 missense probably benign 0.02
R6565:Fat3 UTSW 9 15915327 missense probably benign
R6576:Fat3 UTSW 9 16377210 missense probably damaging 1.00
R6649:Fat3 UTSW 9 16376742 missense probably damaging 1.00
R6716:Fat3 UTSW 9 15919269 missense probably benign
R6719:Fat3 UTSW 9 15996144 missense probably benign
R6753:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6754:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6755:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6792:Fat3 UTSW 9 16375644 missense probably damaging 1.00
R6802:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6803:Fat3 UTSW 9 15996787 missense probably damaging 0.99
R6831:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6831:Fat3 UTSW 9 16376551 missense probably damaging 0.98
R6833:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6877:Fat3 UTSW 9 15999268 missense probably benign
R6894:Fat3 UTSW 9 15997776 missense probably damaging 1.00
R6915:Fat3 UTSW 9 16377748 missense probably benign 0.37
R6931:Fat3 UTSW 9 15959942 missense possibly damaging 0.89
R6934:Fat3 UTSW 9 16376956 missense probably damaging 0.98
R6959:Fat3 UTSW 9 15996885 missense possibly damaging 0.91
R6969:Fat3 UTSW 9 16029916 missense probably benign 0.29
R6986:Fat3 UTSW 9 16021335 missense probably damaging 1.00
X0021:Fat3 UTSW 9 16029931 missense probably null 0.66
X0026:Fat3 UTSW 9 15996333 missense probably benign
X0064:Fat3 UTSW 9 15919277 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCGTAGTGATTGAGCACCACGGAG -3'
(R):5'- TGCAGATGCACACTGGATGGAAC -3'

Sequencing Primer
(F):5'- TCAGGCTGCGGACGTTATC -3'
(R):5'- ACTGGATGGAACATCTGCC -3'
Posted On2014-05-14