Incidental Mutation 'R1699:Krtap16-1'
ID192545
Institutional Source Beutler Lab
Gene Symbol Krtap16-1
Ensembl Gene ENSMUSG00000078253
Gene Namekeratin associated protein 16-1
SynonymsAI450886
MMRRC Submission 039732-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.035) question?
Stock #R1699 (G1)
Quality Score91
Status Not validated
Chromosome11
Chromosomal Location99984710-99986597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99986026 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 184 (E184G)
Ref Sequence ENSEMBL: ENSMUSP00000100671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105050]
Predicted Effect probably damaging
Transcript: ENSMUST00000105050
AA Change: E184G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100671
Gene: ENSMUSG00000078253
AA Change: E184G

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 45 92 3.4e-8 PFAM
Pfam:Keratin_B2_2 88 132 1.8e-11 PFAM
Pfam:Keratin_B2_2 142 191 1.6e-7 PFAM
Pfam:Keratin_B2_2 172 221 9.9e-9 PFAM
Pfam:Keratin_B2_2 198 246 8.2e-5 PFAM
Pfam:Keratin_B2_2 212 266 3.3e-4 PFAM
low complexity region 282 299 N/A INTRINSIC
low complexity region 330 350 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
low complexity region 489 500 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118454
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C02Rik A G 5: 30,483,866 probably null Het
Abca2 A G 2: 25,447,351 E2406G possibly damaging Het
Adam6b T A 12: 113,490,585 F341I probably benign Het
Adam8 A T 7: 139,983,311 N767K possibly damaging Het
AI481877 T C 4: 59,113,926 K13R unknown Het
Aig1 T C 10: 13,868,622 D46G possibly damaging Het
Alms1 A G 6: 85,622,880 I2032V possibly damaging Het
Ankrd16 A G 2: 11,784,393 I264V probably benign Het
Areg T G 5: 91,143,498 V100G probably damaging Het
Bcan A G 3: 87,989,236 Y718H probably damaging Het
Brsk2 T A 7: 141,985,463 I188N probably damaging Het
Ccdc189 A T 7: 127,586,856 probably null Het
Cdt1 T C 8: 122,569,983 Y203H probably damaging Het
Chil3 A C 3: 106,160,366 probably null Het
Cth A G 3: 157,907,436 L253P probably damaging Het
Cyp11b1 A G 15: 74,840,817 F132L possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnah11 A G 12: 118,190,868 S226P probably damaging Het
Egfr A T 11: 16,859,019 Q71L probably benign Het
Eml6 T A 11: 29,746,282 K1940* probably null Het
Epn2 T A 11: 61,523,188 K391* probably null Het
Erich1 A T 8: 14,090,259 S2T possibly damaging Het
Evi5 A C 5: 107,818,920 L245R probably damaging Het
Evpl T C 11: 116,227,588 Y731C probably damaging Het
Exoc3l G A 8: 105,295,013 H128Y probably benign Het
Extl1 G A 4: 134,364,583 Q320* probably null Het
Fam71a T A 1: 191,163,821 E208D probably benign Het
Fam91a1 T A 15: 58,432,948 S416T probably benign Het
Fam96b A G 8: 104,640,086 V132A probably damaging Het
Fat3 A T 9: 15,938,398 S3903T probably damaging Het
Fer1l4 A G 2: 156,029,685 F1392L probably benign Het
Fstl4 T C 11: 53,168,178 I488T possibly damaging Het
Gak A T 5: 108,604,377 Y338* probably null Het
Glp2r T C 11: 67,757,541 T112A probably benign Het
Glrb G A 3: 80,861,774 T180I probably damaging Het
Gm10118 C T 10: 63,926,892 probably benign Het
Gpr19 A T 6: 134,870,229 F72I possibly damaging Het
Grin3b C A 10: 79,975,882 N740K probably damaging Het
Gstk1 A T 6: 42,246,601 T42S probably benign Het
Hoxd1 G A 2: 74,764,282 A294T probably benign Het
Hspg2 T A 4: 137,548,012 probably null Het
Ift74 A T 4: 94,685,703 N472I probably benign Het
Il1a C T 2: 129,302,893 D202N probably damaging Het
Islr T C 9: 58,157,495 D243G probably damaging Het
Kif21a C T 15: 90,959,743 E1098K probably damaging Het
Lrp1b A G 2: 41,185,962 I1889T possibly damaging Het
Mcpt4 A G 14: 56,059,959 *247Q probably null Het
Megf10 T C 18: 57,277,730 probably null Het
Mettl2 T A 11: 105,139,718 H373Q probably benign Het
Mocos A G 18: 24,683,216 K617E probably damaging Het
Ms4a8a A G 19: 11,076,397 I115T probably damaging Het
Ndst1 T C 18: 60,695,508 Y658C probably damaging Het
Nin G A 12: 70,030,938 A1031V probably benign Het
Nin C A 12: 70,045,563 K657N possibly damaging Het
Noc4l G A 5: 110,649,847 R344* probably null Het
Notch2 T C 3: 98,145,127 S1980P probably damaging Het
Npat C T 9: 53,562,660 S584L probably benign Het
Nphp4 A G 4: 152,496,664 T102A probably damaging Het
Olfml2b A G 1: 170,645,073 N51S possibly damaging Het
Olfr1042 T C 2: 86,159,936 I145V probably benign Het
Olfr138 A G 17: 38,275,041 K90R probably benign Het
Olfr1388 T A 11: 49,444,289 I146N possibly damaging Het
Olfr153 A G 2: 87,532,083 T17A probably benign Het
Pced1b T A 15: 97,384,877 W266R probably damaging Het
Pdcd6ip A G 9: 113,678,354 V378A probably damaging Het
Pde8b T A 13: 95,032,866 K683N probably damaging Het
Pfas T G 11: 68,998,046 probably null Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plcd4 T G 1: 74,548,235 S51R probably benign Het
Plekhh2 T A 17: 84,577,184 Y775* probably null Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Ppp4r3b C T 11: 29,213,765 T47I possibly damaging Het
Pter A T 2: 12,994,761 D169V probably damaging Het
Ptpn12 A G 5: 20,998,170 S537P probably benign Het
Ptpru T A 4: 131,779,050 D1067V probably damaging Het
Rcn1 A T 2: 105,399,005 D67E probably damaging Het
Rfc4 T C 16: 23,114,233 E318G probably benign Het
Samd13 C A 3: 146,662,714 R41L probably benign Het
Slc6a2 T C 8: 92,972,812 I156T possibly damaging Het
Spag16 T C 1: 69,996,856 F348L probably benign Het
Spag4 T C 2: 156,065,422 Y21H probably damaging Het
Stam2 G A 2: 52,703,175 A368V possibly damaging Het
Stc1 A T 14: 69,038,327 M190L probably benign Het
Stxbp1 A G 2: 32,800,617 L475P probably damaging Het
Syn3 A T 10: 86,080,211 Y304N probably damaging Het
Tbc1d15 G T 10: 115,220,314 T251K probably benign Het
Tbpl2 A T 2: 24,095,045 M29K probably benign Het
Tead3 T G 17: 28,334,724 Q170H possibly damaging Het
Tpbpb T C 13: 60,902,163 N51D probably benign Het
Tstd3 A G 4: 21,759,400 M124T probably benign Het
Ttyh1 T A 7: 4,119,696 H14Q possibly damaging Het
Tubgcp4 G A 2: 121,189,893 W449* probably null Het
Txndc11 A G 16: 11,087,775 probably null Het
Usp24 T A 4: 106,438,827 D2615E probably damaging Het
Vars A G 17: 35,014,758 E1020G possibly damaging Het
Vmn2r58 A G 7: 41,860,527 I542T probably benign Het
Vwf A G 6: 125,643,069 Y1570C probably damaging Het
Vwf A T 6: 125,685,900 Y2749F possibly damaging Het
Zfand1 A C 3: 10,341,055 V198G possibly damaging Het
Zfp536 G A 7: 37,569,454 T179I probably damaging Het
Zfp599 T C 9: 22,250,404 Y155C probably benign Het
Other mutations in Krtap16-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Krtap16-1 APN 11 99985731 nonsense probably null
IGL00578:Krtap16-1 APN 11 99985295 missense probably benign 0.00
IGL02324:Krtap16-1 APN 11 99986303 missense probably damaging 0.99
R0200:Krtap16-1 UTSW 11 99985297 missense probably damaging 0.96
R0617:Krtap16-1 UTSW 11 99986495 missense probably damaging 1.00
R1785:Krtap16-1 UTSW 11 99985776 nonsense probably null
R2130:Krtap16-1 UTSW 11 99985776 nonsense probably null
R2177:Krtap16-1 UTSW 11 99986449 missense probably damaging 0.99
R4455:Krtap16-1 UTSW 11 99985733 missense probably benign 0.44
R4716:Krtap16-1 UTSW 11 99985174 missense probably damaging 0.99
R5111:Krtap16-1 UTSW 11 99986552 missense possibly damaging 0.90
R5122:Krtap16-1 UTSW 11 99985697 missense probably damaging 0.96
R5254:Krtap16-1 UTSW 11 99985598 nonsense probably null
R5481:Krtap16-1 UTSW 11 99985327 missense probably damaging 0.98
R6557:Krtap16-1 UTSW 11 99985130 missense possibly damaging 0.90
R6884:Krtap16-1 UTSW 11 99986458 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGAGACACATGGTGGCTCACAGG -3'
(R):5'- ACAATGCTGTCAGCCTTCGTGTTC -3'

Sequencing Primer
(F):5'- CCATACAGGCAGATGGCTGAC -3'
(R):5'- AGGCTACCATTTGTGAGCCC -3'
Posted On2014-05-14